| name | bio-qc |
| description | Parse and QC biological sequences and files with Seqeron (MCP tools OR the C# API). Use to parse/validate FASTA, FASTQ, GenBank, GFF, VCF, BED, EMBL; validate DNA/RNA/protein; compute sequence composition (GC%, base/AA counts, Tm/melting temperature, molecular weight, hydrophobicity, pI); measure complexity/entropy (Shannon, DUST, linguistic, k-mer, compression); FASTQ quality stats (Q20/Q30, mean quality, encoding); and transcribe / translate / reverse-complement. Prompts like "parse this file", "extract features from GenBank/GFF", "validate this sequence", "GC content of…", "is this valid DNA/RNA/protein", "quality stats for this FASTQ", "translate this ORF", "reverse complement", "mask low-complexity". Servers: sequence + parsers. |
| allowed-tools | Read, Bash, Grep, Glob |
bio-qc — parse/validate files & sequences, composition, complexity, quality
Routing + orchestration skill for the Sequence (35 tools) and Parsers (41 tools) servers
= 76 tools. It picks the right tool for a parsing / validation / composition / quality question
and gives a dual-mode recipe (MCP tool calls and the equivalent Seqeron.Genomics C# Method IDs).
- Rigor is delegated. Parse-with-a-tool (never interpret FASTA/FASTQ by hand), envelope,
provenance, cross-check, units, and the alpha / not-for-clinical-use caveat are owned by
bio-rigor — applies here by default; do not restate its rules.
- Don't know the tool name? Use
seqeron-discovery
(python3 scripts/skills/find-tool.py <kw> --server sequence|parsers) — never guess.
- Point, don't duplicate. Full I/O schemas live in
docs/mcp/tools/{sequence,parsers}/*.md;
algorithm invariants in docs/algorithms/{Sequence_Composition,Complexity,Quality,Translation,FileIO,Statistics}/.
This skill links, it does not copy.
Envelope STOP rule (one guarded unit in this domain)
- PARSE-FASTQ-001 (
fastq_detect_encoding / FastqParser.DetectEncoding): auto-disambiguation of
Phred+33 vs Phred+64 is guarded → MinimumMode Permissive. When every read is confined to the
ASCII 64–74 overlap the encoding is information-theoretically ambiguous; the call flags Ambiguous
and defaults to Phred+33. STOP and surface the ambiguity — do not silently pick an encoding.
In C# tests this branch needs the Permissive bootstrap (see bio-rigor → reference/envelope.md).
Decision guide — which tool for which question
| Question | Tool ([MCP] / Method ID) |
|---|
| Parse a FASTA / FASTQ / GenBank / GFF / VCF / BED / EMBL file | fasta_parse / fastq_parse / genbank_parse / gff_parse / vcf_parse / bed_parse / embl_parse |
| Is this valid DNA / RNA / protein? | dna_validate / rna_validate / protein_validate (*.TryCreate); quick bool: is_valid_dna / is_valid_rna |
| GC content of a sequence | gc_content / SequenceExtensions.CalculateGcContentFast |
| Base / amino-acid composition | nucleotide_composition / amino_acid_composition |
| One-shot summary (length, GC, counts, Tm…) | summarize_sequence / SequenceStatistics.SummarizeNucleotideSequence |
| Melting temperature (Tm) | melting_temperature / SequenceStatistics.CalculateMeltingTemperature |
| Molecular weight / hydrophobicity / pI | molecular_weight_nucleotide · molecular_weight_protein · hydrophobicity · isoelectric_point |
| Complexity / entropy (screen low-complexity) | complexity_shannon · complexity_dust_score · complexity_linguistic · complexity_kmer_entropy · complexity_mask_low |
| FASTQ quality stats (Q20/Q30, mean Q, encoding) | fastq_statistics · fastq_detect_encoding (guarded — see STOP) |
| Transcribe / translate / reverse-complement | rna_from_dna · translate_dna / translate_rna · dna_reverse_complement |
| Extract features from GenBank / GFF / EMBL | genbank_features · gff_parse(+gff_filter) · embl_features |
Rule of thumb: parse first (tool, not by hand) → validate the alphabet → then measure
(composition / complexity / quality). See reference/tool-map.md for all 76 tools by sub-task.
Canonical dual-mode pipelines
(a) Parse FASTA → validate → composition summary
- [MCP]
fasta_parse(content) → records (id, sequence).
- [MCP]
dna_validate(sequence) → valid, length (stop if valid=false).
- [MCP]
summarize_sequence(sequence) or gc_content + nucleotide_composition.
- [C# API]
FastaParser.Parse → DnaSequence.TryCreate → SequenceStatistics.SummarizeNucleotideSequence (or SequenceExtensions.CalculateGcContentFast + SequenceStatistics.CalculateNucleotideComposition).
Provenance: fasta_parse → dna_validate → summarize_sequence. Envelope: none guarded here. Caveat: alpha.
(b) FASTQ → quality stats
- [MCP]
fastq_detect_encoding(reads) → encoding (guarded; if Ambiguous, STOP & report — do not guess).
- [MCP]
fastq_statistics(content, encoding) → totalReads, meanQuality, q20Percentage, q30Percentage, gcContent.
- [C# API]
FastqParser.DetectEncoding (Permissive bootstrap) → FastqParser.CalculateStatistics.
Provenance: fastq_detect_encoding(encoding=…) → fastq_statistics. Envelope: PARSE-FASTQ-001 (Permissive if ambiguous). Caveat: alpha.
(c) Parse GenBank / GFF → extract features
- [MCP]
genbank_parse(content) → record; genbank_features → feature table; genbank_extract_sequence → per-feature seq.
For GFF: gff_parse → features; gff_filter(type=…) → subset; gff_statistics → counts.
- [C# API]
GenBankParser.Parse → GenBankParser.GetFeatures → GenBankParser.ExtractSequence; GffParser.Parse → GffParser.Filter* → GffParser.CalculateStatistics.
Provenance: genbank_parse → genbank_features (→ genbank_extract_sequence). Envelope: none guarded. Caveat: alpha.
(d) Transcribe / translate / reverse-complement
- [MCP]
rna_from_dna(dna) → RNA; translate_dna(dna) or translate_rna(rna) → protein; dna_reverse_complement(dna) → revcomp.
- [C# API]
RnaSequence.FromDna → Translator.Translate(DnaSequence|RnaSequence); DnaSequence.GetReverseComplementString.
- Cross-check:
translate_dna(dna) should equal translate_rna(rna_from_dna(dna)) (independent paths).
Provenance: (rna_from_dna →) translate_dna/translate_rna; dna_reverse_complement. Envelope: none guarded. Caveat: alpha.
(e) Low-complexity / entropy screen
- [MCP]
complexity_shannon(seq) and/or complexity_dust_score(seq) → complexity metrics; complexity_mask_low(seq) → masked seq.
- [C# API]
SequenceComplexity.CalculateShannonEntropy · .CalculateDustScore · .MaskLowComplexity.
- Use before k-mer/alignment work to flag repetitive / low-information regions.
Provenance: complexity_dust_score + complexity_shannon (→ complexity_mask_low). Envelope: none guarded. Caveat: alpha.
End-to-end grounded example (extends docs/mcp/README.md cloning-QC)
Task. A cloning insert is provided in FASTA. (1) Parse it with a tool (never by hand),
(2) validate it is DNA, (3) report GC% and composition, (4) get its melting temperature,
(5) screen for low complexity — one QC report.
Tool / Method ID chain (MCP names; C# path in parentheses):
fasta_parse(content=">seq1\nGCGCGAATTCATGGATCCATAT") → sequence="GCGCGAATTCATGGATCCATAT". (FastaParser.Parse)dna_validate("GCGCGAATTCATGGATCCATAT") → valid=true, length=22. (DnaSequence.TryCreate)gc_content(sequence) → gcContent≈45.45, gcCount=10, totalCount=22. (SequenceExtensions.CalculateGcContentFast)melting_temperature(sequence) → tm (report the method/params from the tool doc). (SequenceStatistics.CalculateMeltingTemperature)complexity_dust_score(sequence) → DUST score (flag if low-complexity). (SequenceComplexity.CalculateDustScore)
Expected-shape output (compute with the tools, do not eyeball):
| id | length | valid | gc_% | tm_C | dust |
|------|-------:|:-----:|-----:|-----:|-----:|
| seq1 | 22 | yes | 45.45| … | … |
Provenance
1) fasta_parse(content) → sequence (parsed by tool, not manually)
2) dna_validate(sequence) → valid=true, length=22
3) gc_content(sequence) → gcContent=45.45, gcCount=10, totalCount=22
4) melting_temperature(sequence) → tm (see tool doc for method + salt/conc params)
5) complexity_dust_score(sequence) → dust
Envelope: none guarded in this chain (FASTQ encoding would be PARSE-FASTQ-001).
Caveat: alpha software; not for clinical use — validate before relying on any construct decision.
Reference
