| name | bio-rna-structure-secondary-structure-prediction |
| description | Predicts RNA secondary structures using minimum free energy folding and partition function analysis with ViennaRNA (RNAfold, RNAalifold, RNAcofold). Computes base-pair probabilities, centroid structures, and consensus structures from alignments. Use when predicting RNA folding, evaluating structural stability, or comparing structures across homologs. |
| tool_type | cli |
| primary_tool | ViennaRNA |
Version Compatibility
Reference examples tested with: Infernal 1.1+, matplotlib 3.8+, numpy 1.26+
Before using code patterns, verify installed versions match. If versions differ:
- Python:
pip show <package> then help(module.function) to check signatures
- CLI:
<tool> --version then <tool> --help to confirm flags
If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.
Secondary Structure Prediction
"Predict the secondary structure of my RNA sequence" -> Compute minimum free energy (MFE) folding, base-pair probabilities via partition function, and consensus structures from alignments using thermodynamic models.
- CLI:
RNAfold for single-sequence MFE/partition folding
- CLI:
RNAalifold for consensus structure from alignment
- CLI:
RNAcofold for RNA-RNA interaction structure
Predict RNA secondary structures using thermodynamic models. ViennaRNA provides MFE folding, partition function analysis, consensus structure prediction from alignments, and RNA-RNA interaction prediction.
RNAfold: Single Sequence Folding
MFE Structure
echo "GGGAAACCC" | RNAfold
echo "GGGAAACCC" | RNAfold -p
echo ">myRNA" > input.fa
echo "GGGCUAUUAGCUCAGUUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGCUGAUUCGAAUUCAGCAUAGCCCA" >> input.fa
RNAfold -p --noPS < input.fa
Key RNAfold Options
| Option | Description |
|---|
-p | Compute partition function and base-pair probabilities |
--MEA | Compute maximum expected accuracy structure |
-d2 | Dangling end energies on both sides of helices (default) |
-T 37 | Temperature in Celsius (default: 37) |
--noLP | No lonely pairs (isolated base pairs) |
--noPS | Suppress PostScript output files |
-C | Read structure constraints from input |
--shape | Incorporate SHAPE reactivity data |
Constrained Folding
echo -e ">constrained\nGGGCUAUUAGCUCAGUUGGUUAGAGCGCACC\n...xxxx.........................." | RNAfold -C
RNAalifold: Consensus Structure from Alignment
Predicts a consensus structure from a multiple sequence alignment, combining thermodynamic stability with covariation evidence.
RNAalifold --aln alignment.sto
RNAalifold --cfactor 0.6 --nfactor 0.5 -p alignment.sto
RNAalifold --ribosum_scoring alignment.sto
| Option | Description |
|---|
--cfactor | Covariation weight (default: 1.0, lower = more thermodynamic) |
--nfactor | Non-compatible penalty (default: 1.0) |
--ribosum_scoring | Use RIBOSUM matrices for covariation |
-p | Partition function for consensus |
RNAcofold: RNA-RNA Interaction
Predicts the hybridization structure of two RNA molecules.
echo "GCGCGC&GCGCGC" | RNAcofold
echo "GCGCGC&GCGCGC" | RNAcofold -p
LinearFold: Fast Folding for Long Sequences
For sequences longer than ~5,000 nt, LinearFold provides O(n) time complexity instead of O(n^3).
echo "GGGAAACCC" | linearfold
RNAfold --maxBPspan 300 < long_sequence.fa
ViennaRNA Python API
import RNA
sequence = 'GGGCUAUUAGCUCAGUUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGCUGAUUCGAAUUCAGCAUAGCCCA'
structure, mfe = RNA.fold(sequence)
print(f'Structure: {structure}')
print(f'MFE: {mfe:.2f} kcal/mol')
fc = RNA.fold_compound(sequence)
structure_pf, pf_energy = fc.pf()
print(f'Ensemble energy: {pf_energy:.2f} kcal/mol')
bpp = fc.bpp()
centroid, centroid_dist = fc.centroid()
print(f'Centroid: {centroid}')
print(f'Distance to ensemble: {centroid_dist:.2f}')
mea_struct, mea_val = fc.MEA()
print(f'MEA structure: {mea_struct}')
print(f'MEA value: {mea_val:.2f}')
Folding with Constraints (Python)
import RNA
sequence = 'GGGCUAUUAGCUCAGUUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGCUGAUUCGAAUUCAGCAUAGCCCA'
md = RNA.md()
md.uniq_ML = 1
fc = RNA.fold_compound(sequence, md)
fc.hc_add_up(10, RNA.CONSTRAINT_CONTEXT_ALL_LOOPS)
fc.hc_add_bp(1, 72, RNA.CONSTRAINT_CONTEXT_ALL_LOOPS)
structure, mfe = fc.mfe()
print(f'Constrained: {structure} ({mfe:.2f} kcal/mol)')
SHAPE-Constrained Folding (Python)
import RNA
sequence = 'GGGCUAUUAGCUCAGUUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGCUGAUUCGAAUUCAGCAUAGCCCA'
fc = RNA.fold_compound(sequence)
reactivities = [-999] + [0.1, 0.05, 0.8, 0.9, 0.2, 0.1, 0.3]
fc.sc_add_SHAPE_deigan(reactivities, 1.8, -0.6)
structure, mfe = fc.mfe()
print(f'SHAPE-guided: {structure} ({mfe:.2f} kcal/mol)')
Structure Comparison
import RNA
struct1 = '(((....)))'
struct2 = '(((....).))'
bp_dist = RNA.bp_distance(struct1, struct2)
print(f'Base-pair distance: {bp_dist}')
tree1 = RNA.make_tree(RNA.expand_Full(struct1))
tree2 = RNA.make_tree(RNA.expand_Full(struct2))
tree_dist = RNA.tree_edit_distance(tree1, tree2)
print(f'Tree edit distance: {tree_dist}')
Structure Formats
| Format | Description | Example |
|---|
| Dot-bracket | Parentheses for pairs, dots for unpaired | (((...))) |
| CT (connect) | Tab-delimited: index, base, prev, next, pair, index | Standard for mfold |
| BPSEQ | Three columns: position, nucleotide, pair partner (0=unpaired) | Used by comparative databases |
| WUSS | Extended dot-bracket with pseudoknot notation | <<..AA..>>..aa |
Format Conversion
import RNA
sequence = 'GGGAAACCC'
structure = '(((...)))'
pt = RNA.ptable(structure)
pairs = [(i, pt[i]) for i in range(1, len(pt)) if pt[i] > i]
print(f'Base pairs: {pairs}')
for i in range(1, len(sequence) + 1):
print(f'{i} {sequence[i-1]} {pt[i]}')
Visualization
Forna (web-based)
import json
forna_data = {
'sequence': 'GGGCUAUUAGCUCAGUUGGUUAGAGCGCACC',
'structure': '((((....((((......))))....))))'
}
print(json.dumps(forna_data))
R2DT (standardized 2D layouts)
docker run -v $(pwd):/data rnacentral/r2dt draw /data/input.fa /data/output/
Matplotlib Dot Plot
import RNA
import matplotlib.pyplot as plt
import numpy as np
sequence = 'GGGCUAUUAGCUCAGUUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGCUGAUUCGAAUUCAGCAUAGCCCA'
fc = RNA.fold_compound(sequence)
fc.pf()
bpp = fc.bpp()
n = len(sequence)
matrix = np.zeros((n, n))
for i in range(1, n + 1):
for j in range(i + 1, n + 1):
matrix[i-1][j-1] = bpp[i][j]
fig, ax = plt.subplots(figsize=(8, 8))
ax.imshow(matrix, cmap='YlOrRd', origin='lower', vmin=0, vmax=1)
ax.set_xlabel('Position')
ax.set_ylabel('Position')
ax.set_title('Base-pair probability matrix')
plt.tight_layout()
plt.savefig('bpp_dotplot.png', dpi=150)
Quality Thresholds
| Metric | Threshold | Rationale |
|---|
| MFE z-score | < -2.0 | Sequence folds significantly better than shuffled controls |
| Ensemble diversity | < 5.0 | Low diversity indicates a well-defined structure |
| Base-pair probability | > 0.9 | High confidence for individual pairs |
| Covariation score | > 0.0 | Positive covariation supports predicted pair |
Related Skills
- ncrna-search - Classify structured RNAs by family using Infernal/Rfam
- structure-probing - Use experimental SHAPE/DMS data to constrain predictions
- genome-annotation/ncrna-annotation - Genome-wide ncRNA annotation
- sequence-manipulation/sequence-properties - Sequence composition analysis