transcription-translation

name	transcription-translation
description	Transcribe DNA to RNA (and back), translate coding sequences to protein using NCBI codon tables, and pick the right genetic code for mitochondria, plastids, or non-standard organisms.
license	MIT

Transcription and Translation

Hard rules

1. No fabricated citations. Every cited work must resolve to a verifiable
2. No claim without provenance. Every quantitative or factual claim
3. No silent failure. Every script invocation, API call, or tool use must declare its exit status and what to do on non-zero. A skill that silently swallows errors is a violation.

When to use

• mRNA from a coding sequence.
• Protein sequence from a CDS (or whole genome, for prokaryotes).
• Reverse transcription (mRNA → cDNA, U → T).
• Verifying that a predicted ORF really is a CDS (no internal stops, correct frame).

When NOT to use

• Gene finding (de novo ORF detection) → use pyrodigal, prodigal, or MetaGeneAnnotator.
• Genome annotation → use bakta or prokka.
• For translation with frameshifts / selenocysteine → custom logic with NCBITSite.

Prerequisites

• biopython>=1.83

Core workflow

1. Pick the codon table — NCBI table 1 is the standard genetic code.
2. Get the CDS — either a feature from GenBank, or your own extracted ORF.
3. Translate with cds=True if you want validation; cds=False for "translate whatever".
4. Verify — length divisible by 3, no internal stops (or stops are expected for selenocysteine / pyrrolysine).

NCBI codon tables (most common, 2026)

ID	Name	Use
1	Standard	Most organisms
2	Vertebrate Mitochondrial	Human mtDNA, mouse mtDNA
3	Yeast Mitochondrial	S. cerevisiae mtDNA
4	Mold / Protozoan / Coelenterate Mitochondrial	Invertebrate mtDNA
5	Invertebrate Mitochondrial	Many invertebrate mtDNAs
6	Ciliate Nuclear	Tetrahymena, Paramecium
11	Bacterial, Archaeal and Plant Plastid	Chloroplasts, bacteria

Full list: https://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi

Code patterns

Basic transcription and translation

from Bio.Seq import Seq

coding_dna = Seq("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG")
mrna = coding_dna.transcribe()              # T → U
protein = coding_dna.translate()            # MAIVMGR*

Strict CDS validation (cds=True)

protein = coding_dna.translate(cds=True)

This raises Bio.Data.CodonTable.TranslationError if:

• Length is not a multiple of 3.
• The CDS doesn't start with ATG.
• The CDS doesn't end with a stop codon (TAA, TAG, TGA).

For mitochondrial code (table 2), stop codons are different (AGA, AGG, TAA, etc.):

protein = coding_dna.translate(table=2, cds=True)

Reverse transcription (mRNA → cDNA)

mrna = Seq("AUGGCCAUUGUAA")
cdna = mrna.back_transcribe()    # U → T

Translate a non-standard genetic code

# Vertebrate mitochondrial
protein = coding_dna.translate(table=2)

# Yeast mitochondrial
protein = coding_dna.translate(table=3)

Translate to stop (drop the trailing stop)

protein = coding_dna.translate(to_stop=True)  # MAIVMGR

Translate with full table object

from Bio.Data import CodonTable

std = CodonTable.unambiguous_dna_by_id[1]      # standard
mt = CodonTable.unambiguous_dna_by_id[2]       # vertebrate mt

print(std.stop_codons)   # ['TAA', 'TAG', 'TGA']
print(mt.stop_codons)    # ['TAA', 'TAG', 'AGA', 'AGG']
print(std.start_codons)  # ['TTG', 'CTG', 'ATG'] (alt starts in bacteria)

Extract CDS from GenBank and translate

from Bio import SeqIO

rec = next(SeqIO.parse("chr1.gb", "genbank"))
for feat in rec.features:
    if feat.type == "CDS":
        nt = feat.extract(rec.seq)
        protein = nt.translate(cds=True)   # raises if feature is malformed
        print(feat.qualifiers.get("gene", ["?"])[0], protein[:30])

Six-frame translation (for ORF finding)

def six_frames(seq: str, table: int = 1) -> list[str]:
    from Bio.Seq import Seq
    s = Seq(seq)
    rc = s.reverse_complement()
    return [str(s[i:].translate(table=table)) for i in range(3)] + \
           [str(rc[i:].translate(table=table)) for i in range(3)]

Validate a predicted ORF

def validate_cds(seq: str, table: int = 1) -> bool:
    from Bio.Seq import Seq
    s = Seq(seq)
    if len(s) % 3 != 0:
        return False
    if not s.upper().startswith("ATG"):
        return False
    try:
        s.translate(table=table, cds=True)
        return True
    except Exception:
        return False

Common pitfalls

• Translating raw genomic DNA. Eukaryotic genes have introns. Use the CDS feature, not the whole gene.
• Wrong codon table for mitochondria. In vertebrate mtDNA, AGA and AGG are stops, not Arg. In standard code, they code for Arg.
• cds=True is strict. A genuine prokaryotic CDS that uses GTG as a start will fail. Use cds=False if you allow alternative starts.
• Frame confusion. A 900 bp CDS is 300 aa. If you get 297 or 303, your frame is off by 1.
• Forgetting to_stop=True leaves the stop codon as * in the protein. Decide whether you want it.

Validation

• Length of protein ≈ length of CDS / 3.
• First amino acid is M (or fM in mitochondria).
• Last character is * if you didn't use to_stop=True.
• For a real CDS, no internal *.

Open alternatives

Need	Tool
Gene finding (prokaryotic)	pyrodigal, prodigal
Genome annotation	bakta, prokka
Codon usage bias	Bio.SeqUtils.CodonUsage (see codon-usage skill)
Six-frame ORF display	EMBOSS getorf, ORFfinder

References

• Biopython translation: https://biopython.org/docs/latest/api/Bio.Seq.html#Bio.Seq.Seq.translate
• NCBI genetic codes: https://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi
• Companion: ors-bioinformatics-sequence-codon-usage, ors-bioinformatics-sequence-sequence-properties.

Changelog

• 1.0.0 (2026-06-10): Initial adaptation by Pradyumna Jayaram from bio-transcription-translation (bioSkills-main/sequence-manipulation/transcription-translation).

Cross-references

Other skills in this category:

• batch-processing
• bowtie2-alignment
• bwa-alignment
• bwa-mem2-alignment
• codon-usage
• compressed-sequence-files
• fastq-quality-scores
• filter-sequences
• format-conversion
• hisat2-alignment
• motif-search
• paired-end-fastq
• pysam-genomics
• read-write-sequences
• reverse-complement
• sam-bam-basics
• samtools-bam-processing
• seq-objects
• sequence-properties
• sequence-slicing
• sequence-statistics
• star-alignment