Transcribe DNA to RNA and translate to protein using Biopython, with NCBI codon-table selection, CDS validation, and six-frame ORF finding. Use when converting a CDS or ORF to its amino-acid sequence, selecting a non-standard (mitochondrial, bacterial, ciliate) genetic code, validating a coding sequence, or scanning all reading frames.
Instrucciones de origen · Vista previa de solo lectura
name
bio-transcription-translation
description
Transcribe DNA to RNA and translate to protein using Biopython, with NCBI codon-table selection, CDS validation, and six-frame ORF finding. Use when converting a CDS or ORF to its amino-acid sequence, selecting a non-standard (mitochondrial, bacterial, ciliate) genetic code, validating a coding sequence, or scanning all reading frames.
tool_type
python
primary_tool
Bio.Seq
Version Compatibility
Reference examples tested with: BioPython 1.83+
Before using code patterns, verify installed versions match. If versions differ:
Python: pip show <package> then help(module.function) to check signatures
If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.
Transcription and Translation
"Translate my DNA sequence to protein" -> Transcribe DNA to RNA and translate to protein, choosing the right genetic code and validating the reading frame.
The single most dangerous bug in translation is silent: a valid-but-wrong table= argument produces a plausible wrong protein with no error. Translating human mitochondrial DNA with the default Standard code (table 1) inserts where UGA actually codes Trp and truncates at AGA/AGG (which are stops in vertebrate mito). The protein looks real and nothing complains. By contrast, an table id or name raises (loud). Only valid-but-wrong tables corrupt silently.
*
unknown
KeyError
The defense: when the input is a complete coding sequence, pass cds=True. It converts silent traps into loud TranslationError exceptions by validating start, length, and stop. Use it for ORF validation rather than trusting a clean-looking output.
Since the Biopython 1.78 alphabet removal, transcribe(), back_transcribe(), and translate() perform NO type checking. Transcribing a protein or translating the wrong strand returns silent garbage. Confirm the molecule and strand before converting.
Required Import
from Bio.Seq import Seq
from Bio.Data import CodonTable
Transcription Is a String Operation, Not Biology
transcribe() is a pure T->U replacement on the coding (sense) strand; back_transcribe() is U->T. Neither performs splicing, intron removal, 5' capping, or poly-A addition. The Biopython tutorial states plainly that all transcribe does is replace T with U.
coding_dna = Seq('ATGCGATCGATCG')
rna = coding_dna.transcribe() # Seq('AUGCGAUCGAUCG'), T->U only
back = rna.back_transcribe() # Seq('ATGCGATCGATCG'), U->T only
True biological transcription starts from the template strand, so reverse-complement first:
Translation accepts DNA or RNA directly, so explicit transcription is rarely needed before translate().
Translation Basics
coding_dna = Seq('ATGTTTGGT')
coding_dna.translate() # Seq('MFG'), from DNA
Seq('AUGUUUGGU').translate() # Seq('MFG'), from RNA
Stop-Codon Behavior
translate() substitutes stop_symbol (default '*') for EVERY in-frame stop, so internal stops appear as * mid-protein. to_stop=True instead halts at the first in-frame stop and does NOT append the symbol.
seq = Seq('ATGTTTGGTTAAGGG')
seq.translate() # Seq('MFG*G'), stop shown, translation continues
seq.translate(to_stop=True) # Seq('MFG'), halts at first stop
NCBI Codon Tables: Which Code, and the Consequence of the Wrong One
Biopython exposes every NCBI genetic code by integer id or registered name. Selecting the wrong one is the #1 silent bug (see governing principle).
ID
Name
Key reassignments vs Standard
When it matters
1
Standard
none (baseline)
Most nuclear genes
2
Vertebrate Mitochondrial
AGA/AGG -> STOP; AUA -> Met; UGA -> Trp
Human/vertebrate mtDNA (4 stops: UAA, UAG, AGA, AGG)
3
Yeast Mitochondrial
CUN (all four CU*) -> Thr; AUA -> Met; UGA -> Trp
CTG -> Thr lives HERE, not table 12
4
Mold/Protozoan Mito + Mycoplasma/Spiroplasma
UGA -> Trp (only change)
Fungal/protozoan mito; Mycoplasma
5
Invertebrate Mitochondrial
AGA/AGG -> Ser; AUA -> Met; UGA -> Trp
Insect/worm mito (AGA/AGG=Ser, not STOP as in table 2)
6
Ciliate Nuclear
UAA/UAG -> Gln; only UGA stays stop
Tetrahymena, Paramecium (single stop)
11
Bacterial/Archaeal/Plastid
same coding as Standard; expanded starts
Prokaryotes, plastids (differs from 1 mainly in initiation)
12
Alternative Yeast Nuclear
CUG -> Ser (from Leu)
Candida CUG-Ser clade
Explicit correction: CTG -> Thr is table 3 (Yeast Mitochondrial). Table 12 is CUG -> Ser. Do not conflate them.
seq = Seq('ATGGCCTGA')
seq.translate(table=2) # by NCBI integer id
seq.translate(table='Vertebrate Mitochondrial') # by registered name
CodonTable.unambiguous_dna_by_id[2]
CodonTable.unambiguous_dna_by_name['Vertebrate Mitochondrial']
Validating a Coding Sequence with cds=True
Goal: Translate a complete ORF and have any structural defect raise a loud error instead of producing a silent wrong protein.
Approach: Pass cds=True. It enforces four conditions, each raising Bio.Data.CodonTable.TranslationError on failure: (1) first codon is a start codon for the chosen table; (2) length is a multiple of 3; (3) sequence ends in a stop; (4) no internal in-frame stop. A valid alternative start (GTG/TTG/ATT) is translated as M, biologically correct for fMet initiation. The terminal stop is stripped from the output.
Start-codon lists differ by table: table 1 = TTG/CTG/ATG; table 2 = ATT/ATC/ATA/ATG/GTG; table 11 = TTG/CTG/ATT/ATC/ATA/ATG/GTG. A start valid under one table fails under another, which is exactly the loud signal cds=True provides.
translate() Parameters and Edge Cases
Signature (the Seq.translate METHOD): translate(table='Standard', stop_symbol='*', to_stop=False, cds=False, gap='-'). The Seq method defaults to gap='-', while both the module-level Bio.Seq.translate(sequence, ...) function and SeqRecord.translate() default to gap=None.
Partial codon (length not a multiple of 3): emits a BiopythonWarning and SILENTLY drops the trailing 1-2 bases. Easy to miss in a pipeline. Under cds=True the same condition becomes a loud TranslationError.
Gaps: because the Seq method defaults to gap='-', a full gap codon '---' already translates to '-' (e.g. Seq('GTG---GCCATT').translate() -> 'V-AI', no error). A codon mixing gaps and bases ('TT-') raises TranslationError. SeqRecord.translate() instead defaults to gap=None, so even a full '---' codon raises unless gap='-' is passed; mixed gap/base codons still raise. For alignment-derived CDS, preserve codon and alignment semantics with alignment/multiple-alignment or the project's established translation wrapper rather than assuming one gap-normalization policy.
Dual-coding stop tables (27 Karyorelict, 28 Condylostoma, 31 Blastocrithidia Nuclear): these reassign a stop codon so it codes both an amino acid and stop, so to_stop=True raises a ValueError (no single truncation point).
Seq('ATGTTTGG').translate() # BiopythonWarning, trailing 'GG' dropped -> Seq('MF')
Seq('ATGTTTGG').translate(cds=True) # TranslationError: length not a multiple of three
Selenocysteine and Pyrrolysine Are Silently Lost
Selenocysteine (Sec, one-letter U) is encoded by UGA and pyrrolysine (Pyl, one-letter O) by UAG, both normally stop codons. Recoding requires a SECIS (Sec) or PYLIS (Pyl) element that Biopython does NOT detect. No NCBI table maps UGA->U or UAG->O. Naive translation therefore yields * mid-protein, and to_stop=True SILENTLY truncates the protein at that position. Real selenoproteins (GPX, TXNRD, SELENOP) come out truncated or peppered with *. There is no clean Biopython workaround; flag these genes and handle the recoding event manually.
Six-Frame Translation
Goal: Translate a DNA sequence in all six frames (three forward, three reverse) to expose every possible protein product.
Approach: For each strand, offset by 0, 1, 2 bases, trim to a multiple of 3, and translate.
Reference (BioPython 1.83+):
defsix_frame_translation(seq):
frames = []
for strand, s in [('+', seq), ('-', seq.reverse_complement())]:
for frame inrange(3):
length = 3 * ((len(s) - frame) // 3)
fragment = s[frame:frame + length]
frames.append((strand, frame, fragment.translate()))
return frames
seq = Seq('ATGCGATCGATCGATCGATCG')
for strand, frame, protein in six_frame_translation(seq):
print(f'{strand}{frame}: {protein}')
Find All ORFs (Start to Stop)
Goal: Identify all open reading frames (Met to stop) across both strands and all three frames, keeping only those above a minimum length.
Approach: Translate each of the six frames, then scan each translation for Met-to-stop segments meeting the threshold.
Reference (BioPython 1.83+):
deffind_orfs(seq, min_protein_length=30):
orfs = []
for strand, s in [('+', seq), ('-', seq.reverse_complement())]:
for frame inrange(3):
end = frame + 3 * ((len(s) - frame) // 3)
trans = str(s[frame:end].translate())
aa_start = 0whileTrue:
start = trans.find('M', aa_start)
if start == -1:
break
stop = trans.find('*', start)
if stop == -1:
stop = len(trans)
orf = trans[start:stop]
iflen(orf) >= min_protein_length:
orfs.append((strand, frame, start * 3 + frame, orf))
aa_start = start + 1return orfs
seq = Seq('ATGCGATCGATCGATCGATCGTAA')
for strand, frame, pos, orf in find_orfs(seq, min_protein_length=3):
print(f'{strand} frame {frame} pos {pos}: {orf}')
Select the organism's NCBI table; use cds=True to validate
* mid-protein or premature truncation
Selenoprotein/pyrrolysine UGA/UAG, or wrong table where UGA=Trp
Use correct mito table for UGA=Trp; Sec/Pyl recoding is not automatic
TranslationError: First codon ... is not a start codon
cds=True on a sequence not starting at a valid start for that table
Trim to the true start, or pick the table whose starts include it
TranslationError: ... is not a multiple of three
cds=True on a partial CDS
Trim to a full ORF; without cds=True this only warns and drops trailing bases
TranslationError: Extra in frame stop codon found
Internal stop under cds=True
Wrong frame, wrong table, or genuine internal stop; re-check frame/table
Garbage protein from a protein input
transcribe()/translate() on a non-nucleotide Seq (no type checks since 1.78)
Verify molecule type before converting
KeyError
Unknown table id or name
Use a valid NCBI id (1-6, 9-16, 21-31) or registered name
Decision Tree
Need to convert a sequence?
├── DNA <-> RNA (string-level T<->U)?
│ ├── coding strand to RNA -> seq.transcribe()
│ ├── RNA back to DNA -> seq.back_transcribe()
│ └── template strand to mRNA -> seq.reverse_complement().transcribe()
├── DNA/RNA to protein?
│ ├── alignment-derived CDS -> alignment/multiple-alignment (codon-aware), or project wrapper
│ ├── complete CDS to validate -> translate(cds=True) [loud on defects]
│ ├── stop at first stop only -> translate(to_stop=True)
│ ├── non-standard organism -> translate(table=N) [pick from the table above]
│ └── show internal stops -> translate() [* per stop]
└── Unknown coding regions? -> six-frame translation, then scan M...* for ORFs
Related Skills
seq-objects - Create and inspect Seq objects before translation
reverse-complement - Strand handling for six-frame translation and template-strand transcription
codon-usage - Analyze codon bias and adaptation in coding sequences
sequence-io/read-sequences - Parse GenBank/FASTA records and CDS features for translation
References
The genetic-code tables and their organism assignments follow the NCBI Taxonomy "The Genetic Codes" page, compiled by Andrzej (Anjay) Elzanowski and Jim Ostell at NCBI (https://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi). This is a maintained web resource; cite it as the NCBI page rather than as a journal article.
