Identify direct miRNA-target interactions from AGO HITS-CLIP, AGO-CLEAR-CLIP (chimeric reads), HEAP (Halo-Ago2 mouse), chimeric eCLIP / miR-eCLIP (deep miRNA-target profiling), or CLASH using chimeric-read processing pipelines, seed-pairing analysis, and 3' auxiliary pairing rules. Use when distinguishing direct miRNA targets from indirect, integrating CLIP-derived target maps with TargetScan / miRDB / DIANA predictions, applying canonical 7mer-8mer seed matching with 3' UTR context, or recovering miRNA-mRNA chimeras at scale.
Identify direct miRNA-target interactions from AGO HITS-CLIP, AGO-CLEAR-CLIP (chimeric reads), HEAP (Halo-Ago2 mouse), chimeric eCLIP / miR-eCLIP (deep miRNA-target profiling), or CLASH using chimeric-read processing pipelines, seed-pairing analysis, and 3' auxiliary pairing rules. Use when distinguishing direct miRNA targets from indirect, integrating CLIP-derived target maps with TargetScan / miRDB / DIANA predictions, applying canonical 7mer-8mer seed matching with 3' UTR context, or recovering miRNA-mRNA chimeras at scale.
Before using code patterns, verify installed versions match. If versions differ:
Python: pip show <package> then help(module.function) to check signatures
CLI: <tool> --version then <tool> --help to confirm flags
If code throws unexpected errors, introspect the installed package and adapt the example to match the actual API rather than retrying.
AGO-CLIP and miRNA Target Identification
"Identify direct miRNA-target interactions experimentally" -> Use Argonaute (AGO1-4) CLIP-seq variants to map miRNA-binding sites on mRNAs, then resolve which miRNA pairs with each site. Three approaches: (a) standard AGO-CLIP recovers AGO-bound sites but cannot say which miRNA; (b) chimeric methods (CLEAR-CLIP, chimeric eCLIP / miR-eCLIP) ligate the miRNA to its target during library prep, producing miRNA-mRNA chimeric reads that unambiguously assign miRNA-target pairs; (c) HEAP uses HaloTag-Ago2 for in vivo profiling. The chimeric methods are the gold standard for direct miRNA-target identification; standard AGO-CLIP must be combined with computational seed-matching (TargetScan, miRDB) to infer miRNA pairing. Resolution: chimeric reads pinpoint single miRNA-target pairs; AGO-only CLIP identifies "AGO-binding sites" of which a subset are miRNA targets.
Python (seed-pairing analysis on AGO CLIP peaks): scan peaks for canonical 7mer-m8, 7mer-1A, 8mer, 6mer seeds + 3' UTR position + miRNA expression filter
The Yeo lab miR-eCLIP / chimeric eCLIP is the modern depth-improved version of chimeric AGO-CLIP, enriching for chimeras of specific miRNAs of interest via PCR or on-bead probe capture. For comprehensive miRNA-target mapping, miR-eCLIP combined with eCLIP-seq-style normalization is the state-of-the-art.
Methods Taxonomy
Method
Year
miRNA-target pairing
Chimera enrichment
Strength
Fails when
HITS-CLIP for AGO
2009 (Chi)
Indirect (computational seed)
None
Original; widely cited
Cannot assign miRNA without computational prediction
PAR-CLIP for AGO
2010 (Hafner)
Indirect
None
T->C signature at CL position
Restricted to 4SU-permissive cells
AGO-CLEAR-CLIP (Moore 2015)
2015
Direct (chimera)
None (incidental)
First direct miRNA-target chimera method
Chimeric reads only 1-5% of library; deep sequencing needed
CLASH (Helwak 2013)
2013
Direct (chimera)
None
First general chimera method; pan-Argonaute
Lower chimera rate than CLEAR-CLIP
HEAP (Li 2020)
2020
Indirect (with chimeric step)
None
HaloTag-Ago2 in vivo mouse strain
Mouse only; requires transgenic model
chimeric eCLIP / miR-eCLIP
2022
Direct (chimera)
Probe/PCR enriched
Deepest miRNA-target chimera profiling
Specialized library prep
AGO-IP-microarray (Karginov 2007)
2007
Indirect
None
Earliest; predecessor of CLIP for AGO
No crosslinking; misses transient targets
Methodology evolves; verify the current chimeric eCLIP / miR-eCLIP literature for best practice. As of 2024, miR-eCLIP is the canonical approach for deep miRNA-target profiling.
Critical Choice: Chimeric vs Computational miRNA-Target Pairing
Two fundamentally different strategies:
Chimeric methods (CLEAR-CLIP, chimeric eCLIP / miR-eCLIP, CLASH): During library prep, a ligation step covalently joins the miRNA to its target mRNA, producing chimeric reads (miRNA at 5' + target mRNA at 3'). The miRNA-target pair is read directly from the sequence. Pro: direct evidence of binding interaction; no inference. Con: chimera rate is 1-5% of library by default (substantially enriched with miR-eCLIP probe capture for specific miRNAs); deep sequencing or enrichment needed.
Computational pairing (HITS-CLIP / PAR-CLIP + seed-matching): Standard AGO CLIP identifies AGO-bound peaks; downstream computational scanning matches each peak against canonical miRNA seeds (7mer-m8, 7mer-1A, 8mer) from TargetScan, miRDB, or DIANA databases. Pro: any AGO CLIP data can be analyzed; no special library prep. Con: indirect; assigns miRNAs based on canonical seed rules, missing non-canonical interactions (3' compensatory, central pairing).
The CLEAR-CLIP analysis (Darnell lab, Moore 2015) revealed substantial 3' auxiliary pairing beyond canonical seeds: many miRNA-target interactions have weak or non-canonical seed matching but strong 3' supplementary pairing. Chimeric methods recover these; computational seed-only inference misses them.
Goal
Method
Direct miRNA-target pair identification
Chimeric eCLIP / miR-eCLIP
Specific miRNA's targets (deep)
miR-eCLIP with probe-capture enrichment
All AGO-binding sites (any miRNA)
Standard AGO eCLIP / HITS-CLIP
In vivo mouse tissue
HEAP (Halo-Ago2 mouse)
Pan-Argonaute interactome
CLASH or chimeric eCLIP
Initial discovery / cost-conscious
AGO HITS-CLIP + TargetScan
Non-canonical / 3'-compensatory miRNA pairing
Chimeric methods (CLEAR-CLIP)
Comparison across species
TargetScan + AGO HITS-CLIP (computational)
Validate specific miRNA-target prediction
miR-eCLIP with that miRNA's probe
miRNA-Target Pairing Rules
Computational seed-matching against TargetScan / miRDB requires understanding the canonical miRNA-target pairing rules:
Seed type
Pairing positions (miRNA nt)
Position 1
Pro / Con
8mer
2-7 + position 8 + A at position 1
A required
Strongest; most conserved targets
7mer-m8
2-7 + position 8 (no A1 requirement)
Any
Strong; common
7mer-A1
2-7 (no position 8) + A at position 1
A required
Moderate; common
6mer
2-7
Any
Weak; very common (many false positives)
6mer-A1
2-6 + A at position 1
A required
Weak
3'-compensatory
Weak 6mer + strong 3' UTR pairing 12-17
Any
Discovered via CLEAR-CLIP; misses in seed-only methods
Central pairing
Positions 4-15 with no seed
Any
Rare; cleavage rather than translational repression
For TargetScan integration: download the TargetScanHuman 8.0 conserved-site predictions; filter for 7mer-8mer (drop 6mer if too noisy); cross-reference with the CLIP peak BED of the analysis.
Chimeric eCLIP / miR-eCLIP Workflow
Goal: Recover miRNA-mRNA chimeras from AGO chimeric eCLIP / miR-eCLIP libraries and produce a per-miRNA target list suitable for direct biological interpretation.
Approach: Apply eCLIP-style preprocessing, then run Hyb in chimera (type=mim) mode with bowtie2 alignment (required for short 21-23 nt miRNA sequences), filter chimeras to human mRNA targets, intersect with miRNA-expression atlas (filter > 100 TPM in matched cell type), and validate top targets against TargetScan conserved 7mer-m8 / 8mer predictions.
# Step 1: eCLIP-style preprocessing (see clip-seq/clip-preprocessing)
umi_tools extract --bc-pattern=NNNNNNNNNN \
--stdin=R1.fq.gz --read2-in=R2.fq.gz \
--stdout=R1.umi.fq.gz --read2-out=R2.umi.fq.gz
cutadapt -a AGATCGGAAGAGCACACGTCT -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
-q 6 -m 18 -o R1.trim.fq.gz -p R2.trim.fq.gz \
R1.umi.fq.gz R2.umi.fq.gz
# Step 2: Chimera-specific alignment# Chimeric reads have miRNA sequence (21-23 nt) at 5' followed by target mRNA# Step 2a: Trim 5' for miRNA portion + align miRNA part# Step 2b: Trim 3' for target mRNA portion + align target part# Use custom chimeric-eCLIP pipeline OR Hyb (Travis 2014)# Hyb pipeline approach (CLEAR-CLIP and chimeric methods)
hyb \
in=R1.trim.fq.gz \
db=miRNA_and_human_mRNA.fa \
align=blastall \
type=mim # multimer (miRNA-target) chimera mode# Output: .blast and .hyb files with miRNA-mRNA chimera coordinates# Step 3: Filter chimeras by miRNA + target alignment quality# Hyb reports each chimera as: miRNA_id target_id miRNA_alignment target_alignment# Filter for:# - miRNA portion 18-25 nt# - Target portion 18-50 nt# - miRNA-target seed match (7mer-m8 / 7mer-A1 / 8mer)# - Target alignment unique
awk '$5 == "human_mRNA"' chimeras.hyb > chimeras_human_mRNA.tsv
# Step 4: Aggregate chimeras into per-miRNA target list# Each miRNA -> targets (with read counts as binding affinity proxy)
awk '{print $3, $4}' chimeras_human_mRNA.tsv | sort | uniq -c | sort -rn > mirna_target_counts.tsv
CLEAR-CLIP (Moore 2015) Analysis
CLEAR-CLIP was the first method to recover ~130k miRNA-target chimeras from mouse brain (Moore 2015). The analytical insight: AGO-CLIP reads ligated together during library prep produce chimeric reads at low rates that contain unambiguous miRNA-target pairs.
# CLEAR-CLIP analysis uses the Hyb pipeline (Travis 2014)# Pre-requisite: AGO HITS-CLIP / PAR-CLIP BAM# Extract candidate chimeric reads (reads that don't fully align to human mRNA)
samtools view -h dedup.bam | awk '$6 ~ /S/' | wc -l # soft-clipped reads candidate chimeras# Run Hyb in chimera mode
hyb \
in=R1.trim.fq.gz \
db=mature_miRNA_plus_human_mRNA.fa \
align=blastall \
type=mim
# Filter for canonical seed match
python analyze_chimeras.py \
--chimeras chimeras.hyb \
--mirna_db mature_human_miRNA.fa \
--seed_types 7mer-m8 7mer-A1 8mer \
--output validated_chimeras.tsv
miR-eCLIP Probe Enrichment
To recover deep coverage of one or a few miRNAs' targets, miR-eCLIP uses probe-based or PCR-based enrichment to amplify chimeras containing specific miRNAs.
# After chimera identification, filter for specific miRNA# Example: enrich for hsa-miR-21 targets
grep "hsa-miR-21" chimeras_human_mRNA.tsv > mir21_targets.tsv
# Count unique target sites per miRNA
awk '{print $3}' mir21_targets.tsv | sort -u | wc -l
# Cross-reference with TargetScan conserved predictions for validation
bedtools intersect -wa -wb \
-a mir21_targets_3utr_coords.bed \
-b targetscan_mir21_conserved_targets.bed > mir21_validated_targets.bed
Per-Method Failure Modes
Standard AGO-CLIP -- Cannot assign miRNA
Trigger: Standard AGO eCLIP / HITS-CLIP run; user wants per-miRNA target list.
Mechanism: Standard AGO-CLIP enriches for AGO-bound RNAs but does not retain miRNA identity. Computational seed-matching infers which miRNAs are likely bound but each peak gets matched to dozens of candidate miRNAs.
Symptom: Peak BED has 100k peaks; seed-matching assigns 10-50 candidate miRNAs per peak.
Fix: Switch to chimeric method for direct pairing, OR filter computational predictions by miRNA expression in the same cell type (only consider miRNAs > 100 TPM in matched small-RNA-seq).
Chimeric methods -- Low chimera rate
Trigger: Standard chimeric eCLIP without probe enrichment; expecting deep per-miRNA targets.
Mechanism: Chimeras are 1-5% of total reads in standard chimeric eCLIP. For a 30M-read library, only 300k-1.5M chimeras; distributed across 200+ miRNAs gives only ~5000-15000 per miRNA.
Symptom: Per-miRNA target count is sparse; rare miRNAs have < 100 chimeras.
Fix: Use miR-eCLIP with probe enrichment for specific miRNAs of interest (substantial boost). Or sequence ultra-deep (200M+ reads) for global chimera profiling.
Hyb -- BLAST sensitivity vs miRNA length
Trigger: miRNA sequences (21-23 nt) too short for BLAST default sensitivity.
Mechanism: BLAST defaults need >= 100 nt for reliable alignment. miRNA 21-23 nt hits below threshold; many true chimeras lost.
Symptom: Hyb returns few chimeras; rerun with align=bowtie2 gives more.
Fix: Use bowtie2 mode for miRNA alignment (hyb align=bowtie2 type=mim); short-read aligners are designed for short sequences.
Computational seed matching -- High false positive
Trigger: TargetScan predictions used as ground truth without CLIP validation.
Mechanism: TargetScan reports all potential 7mer-m8 / 8mer matches in 3' UTRs; many sites are not functional miRNA targets (no AGO binding observed).
Symptom: TargetScan predicts thousands of targets per miRNA; only a fraction are validated by CLIP.
Fix: Use CLIP overlap as the validation: TargetScan prediction AND AGO-CLIP peak = high-confidence target. Sites in TargetScan but not in CLIP = unfunctional predictions.
Mechanism: A substantial fraction of miRNA-target interactions have weak seeds but strong 3' UTR pairing (positions 12-17). Seed-only matching loses these.
Symptom: Chimeric methods find targets that TargetScan misses; these have weak seeds.
Fix: Accept chimeric method's targets even with weak seeds (the chimera IS the evidence). Or use TargetScan + RNAhybrid (full miRNA-target duplex prediction) for non-canonical sites.
HEAP -- Mouse-only
Trigger: Want HEAP-style in vivo AGO profiling in human tissue.
Mechanism: HEAP uses a transgenic mouse with Halo-Ago2 allele; not available in human or other species.
Symptom: Cannot replicate HEAP results in human.
Fix: Use eCLIP / chimeric eCLIP on human samples; HEAP is specifically for mouse tissue studies.
miRNA expression filter forgotten
Trigger: Computational miRNA-target assignment without filtering by miRNA expression.
Mechanism: Many miRNA databases include rare or developmental-specific miRNAs. If the miRNA is not expressed in the cell type, it cannot bind anything.
Symptom: Per-miRNA target lists include miRNAs at < 1 TPM expression - implausible binding.
Fix: Cross-reference with matched small-RNA-seq from the same cell type; filter for miRNAs > 100 TPM. ENCODE-validated cell types have published miRNA atlases.
Decision Tree by Use Case
Scenario
Method
Why
Direct miRNA-target identification, modern
chimeric eCLIP / miR-eCLIP
Direct chimeras; deep enrichment available
Specific miRNA's deep target list
miR-eCLIP with probe for that miRNA
probe-based enrichment
Discover novel miRNA-target interactions
CLEAR-CLIP or chimeric eCLIP
Direct chimera, no seed prior
In vivo mouse tissue
HEAP (Halo-Ago2 mouse)
Mouse only
Initial AGO-binding site discovery
AGO HITS-CLIP / eCLIP
Cost-effective; no chimera
Compare miRNA targets across species
TargetScan + AGO HITS-CLIP each species
Computational + experimental
3' compensatory / non-canonical
CLEAR-CLIP / chimeric eCLIP
Direct chimera captures non-canonical
miRNA-perturbation effects
KD/KO + AGO-CLIP + differential
See clip-seq/differential-clip
Cross-tissue miRNA profiling
AGO eCLIP each tissue
Tissue-specific cell-type
Validate single miRNA prediction
miR-eCLIP with that miRNA's probe
Direct experimental confirmation
Reconciliation: AGO-CLIP vs TargetScan vs Chimeric
Pattern
Likely cause
Action
Chimera method finds targets TargetScan does not
Non-canonical / 3'-compensatory pairing
Trust chimera; novel target
TargetScan predicts; AGO eCLIP peak present; no chimera
Functional target without chimera in library
Likely real target; chimera capture stochastic
TargetScan predicts; no AGO eCLIP peak
Computational false positive
Not a functional target
AGO eCLIP peak; no TargetScan match
Non-canonical or rare miRNA seed
Investigate; may be 3' compensatory
Per-miRNA target counts vary 100x across miRNAs
miRNA expression varies
Filter by matched small-RNA-seq
Hyb chimeras 1% of library
Standard rate
Enrich with miR-eCLIP if needed
Different chimera tools give different counts
Algorithm sensitivity differs
Hyb is the most-cited; use it for canonical
HEAP and eCLIP discordant
Mouse vs human; in vivo vs cell line
Both correct in their context
miR-eCLIP enriched chimera count not 30x baseline
Probe inefficient
Verify probe design; use multiple probes per miRNA
Operational rule: For publication-grade miRNA-target list: (a) chimeric eCLIP / miR-eCLIP for direct pairing; (b) cross-reference with TargetScan conserved predictions; (c) filter by miRNA expression > 100 TPM in matched small-RNA-seq; (d) validate top targets with reporter assay (luciferase / GFP fusion with target 3' UTR).
Common Errors
Error / symptom
Cause
Solution
Hyb returns few chimeras
BLAST too stringent for short miRNAs
Use bowtie2 mode (hyb align=bowtie2)
Per-miRNA target list sparse
Low chimera rate without enrichment
Use miR-eCLIP probe enrichment
TargetScan predicts thousands per miRNA
No CLIP filter
Require CLIP peak overlap for high-confidence
miRNA assignments dominate by unexpressed miRNAs
No expression filter
Filter by matched small-RNA-seq > 100 TPM
Non-canonical sites missed
Seed-only matching
Use chimeric methods; or RNAhybrid full duplex
HEAP results don't replicate in human
Mouse-specific transgenic
Use eCLIP / chimeric eCLIP in human
6mer matches dominate target list
Most weak seeds
Restrict to 7mer-m8 / 8mer; report 6mer separately
miRNA target chimeras unstrand-resolved
Strand information lost
Check BED column 6 throughout pipeline
Cross-tissue comparison naive
Tissue-specific miRNA expression
Match tissue-specific miRNA atlases
miR-eCLIP enrichment fails
Probe non-specific or low-affinity
Design multiple probes per miRNA; validate enrichment
References
Chi SW et al 2009 Nature 460:479 (AGO HITS-CLIP)
Hafner M et al 2010 Cell 141:129 (PAR-CLIP for AGO)
Helwak A et al 2013 Cell 153:654 (CLASH; chimera method)
Travis AJ et al 2014 Methods 65:263 (Hyb pipeline)
Moore MJ et al 2015 Nat Commun 6:8864 (CLEAR-CLIP, 130k chimeras mouse brain)
Li X et al 2020 Mol Cell 79:167 (HEAP, Halo-Ago2 in vivo mouse)
Agarwal V et al 2015 eLife 4:e05005 (TargetScan 7.0)
Lewis BP et al 2003 Cell 115:787 (original 7mer/8mer seed rules)
