cloning

name	cloning
description	Decision trees and workflows for molecular cloning in structural biology labs. Use when the user asks about cloning strategies, LIC vs Gibson, biGBac assembly, tag selection, expression system choice (insect vs E. coli), codon optimization, or designing constructs.
allowed-tools	Bash(primer_cli:*) Bash(codon_optimize_cli:*) Bash(plasmidsaurus_cli:*) Bash(orf_verifier_cli:*)

Cloning Skill

Decision tree and workflows for molecular cloning in structural biology labs.

Expression System Selection

Criteria	System	Vector Series
Multi-subunit complexes	Insect cells	438 series
Large proteins (>85 kDa)	Insect cells	438 series
Known E. coli expressers	E. coli	Series 1
Small proteins / domains	E. coli	Series 1

Default assumption: If unsure, larger/complex proteins go to insect cells.

For baculovirus/insect cell expression workflow, see: skills/insect-cell/SKILL.md

Cloning Method Selection

Start
  │
  ├─► Try LIC first (default for 438 and Series 1 vectors)
  │     │
  │     ├─► Success → proceed
  │     │
  │     └─► Failed → use NEB HiFi DNA Assembly (Gibson)
  │
  └─► CPEC: largely replaced, rarely used now

LIC is the default. Only switch to Gibson (NEB HiFi) if LIC fails.

Insert Source

Situation	Approach
Plasmid with ORF exists	PCR amplify
No existing template	Gene synthesis (Twist)

Gene synthesis is now preferred over classic cloning for new constructs.

Codon Optimization

• Always codon optimize for the target expression system
• Tool: IDT Codon Optimization Tool
• Optimize for E. coli or insect cells depending on expression system
• Use codon_optimize_cli.py for batch processing

Tag Strategy

Default

• N-terminal His6-MBP-TEV (cleaved during purification)
• LIC tag version: v1 (no ATG in ORF)

When to Deviate

Condition	Tag Position
N-terminus buried (structure/AlphaFold)	C-terminal
N-terminus involved in binding	C-terminal
Literature precedent suggests otherwise	Follow literature

Always check: AlphaFold prediction or existing structures before deciding tag position.

Multi-Subunit Complexes (biGBac)

Always use biGBac for multi-subunit complexes. Goal: all subunits in one plasmid.

Capacity

Vector	Max Subunits
pBig1	5 subunits
pBig2	5 × pBig1 = up to 25 subunits

Assembly Strategy

1. Clone individual subunits into 438 acceptor vectors (LIC)
2. Combine up to 5 into pBig1 (Gibson assembly)
3. If needed, combine pBig1s into pBig2
4. Alternatively: split across two plasmids and co-infect (validated approach, works for multiple projects)

biGBac Gibson Assembly Protocol

1. PCR amplify each insert (3× 50 µL reactions per insert)
2. Gel purify all PCRs on single column
3. Calculate amounts using BigBacAssembler (Notion tool)
4. Mix in 10 µL total:
   • 100 ng SwaI-digested pBig1 vector (or 50 ng minimum)
   • 3-5× molar excess of each insert
   • Limit gel-extracted DNA to 5 µL per 20 µL reaction
5. Add 10 µL 2× Gibson assembly master mix (NEB HiFi)
6. Incubate 50°C for 1 hour
7. Transform entire reaction → plate on LB-spectinomycin

Tips:

• 3× insert excess sufficient (per Seychelle)
• 50 ng vector also works
• Promega Wizard Kit gives higher yields for gel extraction

LIC Protocol Specifics

Parameter	Value
Insert size limit	None (any size works)
T4 polymerase treatment	22°C for 30 min, then 75°C for 20 min
Vector versions	v1 (N-term tag), v2 (untagged), v3 (C-term tag)

LIC Reaction Setup

Vector treatment (dGTP):

Component	Volume
Gel-purified linearized vector (150 ng)	10 µL
25 mM dGTP stock	2 µL
T4 DNA pol 10× buffer	2 µL
100 mM DTT	1 µL
T4 DNA polymerase	0.4 µL
H₂O	4.6 µL

Insert treatment (dCTP):

Component	Volume
Gel-purified PCR (150 ng)	10 µL
25 mM dCTP stock	2 µL
T4 DNA pol 10× buffer	2 µL
100 mM DTT	1 µL
T4 DNA polymerase	0.4 µL
H₂O	4.6 µL

Annealing: 2 µL LICed PCR + 2 µL LICed vector, RT for 10 min

Transformation: 2.5 µL annealed product → 100 µL DH5α, heat shock 42°C/45s

LIC Overhangs (MacroLab)

Tag	Forward	Reverse
v1 (N-term)	TACTTCCAATCCAATGCA	TTATCCACTTCCAATGTTATTA
v2 (untagged)	TTTAAGAAGGAGATATAGATC	TTATGGAGTTGGGATCTTATTA
v3 (C-term)	TTTAAGAAGGAGATATAGTTC	GGATTGGAAGTAGAGGTTCTC

Quality Control

Sequencing

• Plasmidsaurus (nanopore long-read) for all clones
• Covers entire plasmid in one read

Verification Criteria

• 100% identity to reference = PASS
• Anything less = FAIL (no exceptions for "minor" variants)

Workflow

1. Pick colonies → grow overnight
2. Miniprep
3. Submit to Plasmidsaurus
4. Analyze with orf_verifier_cli.py or plasmidsaurus_cli.py
5. 100% correct → Add to LabBook registry

CLI Tools

# Design LIC primers
python3 scripts/primer_cli.py lic --sequence ATGXXX... --tag v1

# Codon optimize for insect cells
python3 scripts/codon_optimize_cli.py --sequence ATGXXX... --organism insect

# Analyze Plasmidsaurus results
python3 scripts/plasmidsaurus_cli.py analyze /path/to/results/

# Verify ORF against reference
python3 scripts/orf_verifier_cli.py --input clone.gb --reference uniprot_id

# biGBac assembly calculator (from Notion)
python3 big_bac_assembler_Notion.py

Protocol References

Protocol	File
LIC	protocols/Ligation-Independent Cloning (LIC) (prt_tOYB7mRe).md
biGBac	protocols/BigBac Cloning (prt_atebFqGl).md
biGBac tips	protocols/BigBac (additional advice from Seychelle, February 2020) (prt_7eqRkXm0).md

Notion Resources

• BigBac Assembler: Tool for calculating Gibson assembly amounts
• LIC vectors database: <YOUR_NOTION_DB_ID>
• Series-438 database: <YOUR_NOTION_DB_ID>

Related Skills

• Insect cell expression: skills/insect-cell/SKILL.md — baculovirus, transfection, V0/V1, large-scale

Common Failure Modes

Problem	Likely Cause	Solution
No colonies	Ligation failed, incompetent cells	Check LIC reaction, use fresh competent cells
Wrong size insert	Mispriming, template contamination	Gel purify PCR product, check primers
Mutations in sequence	PCR errors	Use high-fidelity polymerase, reduce cycles
Incomplete assembly (biGBac)	Too many fragments	Split into fewer fragments, optimize ratios

Workflow Summary

1. Decide expression system (size/complexity → insect vs E. coli)
2. Design construct (check tag position with AlphaFold)
3. Get insert (PCR from plasmid OR gene synthesis + codon optimize)
4. Clone (LIC first, Gibson if LIC fails)
5. For multi-subunit: biGBac assembly
6. Sequence (Plasmidsaurus)
7. Verify 100% identity
8. Register in LabBook

---

Last updated: 2026-01-17