Skip to main content

bio-workflows-clip-pipeline

End-to-end CLIP-seq analysis from FASTQ to binding sites and motif enrichment. Use when analyzing protein-RNA interactions from CLIP-based methods.

Jump to install

Source facts

Repository
mdbabumiamssm/LLMs-Universal-Life-Science-and-Clinical-Skills-
Last source activity
February 4, 2026 at 19:55
Detected SKILL.md language
English
Stars
31
Forks
8

Install options

The review-first prompt is selected by default. You can switch to a direct command or download a local copy.

Review the source files

Read SKILL.md and any companion files shown by SkillsMP before deciding whether to install.

File Explorer
3 files

Showing SKILL.md

SKILL.md
Source instructions · Read-only preview
name
bio-workflows-clip-pipeline
description
End-to-end CLIP-seq analysis from FASTQ to binding sites and motif enrichment. Use when analyzing protein-RNA interactions from CLIP-based methods.
tool_type
mixed
primary_tool
CLIPper
# CLIP-seq Pipeline ## Pipeline Overview ``` FASTQ → QC → UMI extract → Trim adapters → Align → Filter → Dedup → Peak call → Annotate → Motifs ``` ## CLIP Method Variants | Method | UMI | Crosslink Site | Adapter | |--------|-----|----------------|---------| | HITS-CLIP | Optional | Deletions | 3' adapter | | PAR-CLIP | Optional | T→C mutations | 3' adapter | | iCLIP | Required | 5' of read | 3' adapter | | eCLIP | Required | 5' of read | 3' adapter | ## Step 1: Quality Control ```bash # Initial QC fastqc reads.fastq.gz -o qc_pre/ # Check for adapter contamination and UMI structure # For eCLIP: expect 10nt UMI at read start zcat reads.fastq.gz | head -n 100 | cut -c1-15 ``` ## Step 2: UMI Extraction ```bash # eCLIP (10nt UMI at 5' end) umi_tools extract \ --stdin=reads.fastq.gz \ --bc-pattern=NNNNNNNNNN \ --stdout=extracted.fastq.gz \ --log=umi_extract.log # iCLIP (5nt experimental barcode + 5nt UMI) umi_tools extract \ --stdin=reads.fastq.gz \ --bc-pattern=NNNNNXXXXX \ --stdout=extracted.fastq.gz ``` ## Step 3: Adapter Trimming ```bash # Trim 3' adapter (common eCLIP adapter) cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \ --minimum-length 20 \ --quality-cutoff 20 \ -o trimmed.fastq.gz \ extracted.fastq.gz # For paired UMI adapters cutadapt -a AGATCGGAAGAGCACACGTCT \ -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \ --minimum-length 20 \ -o trimmed_R1.fq.gz -p trimmed_R2.fq.gz \ extracted_R1.fq.gz extracted_R2.fq.gz ``` ## Step 4: Alignment ```bash # Build STAR index (once) STAR --runMode genomeGenerate \ --genomeDir star_index \ --genomeFastaFiles genome.fa \ --sjdbGTFfile genes.gtf \ --sjdbOverhang 100 # Align with STAR (optimized for short CLIP reads) STAR --genomeDir star_index \ --readFilesIn trimmed.fastq.gz \ --readFilesCommand zcat \ --outFilterMismatchNmax 2 \ --outFilterMultimapNmax 1 \ --outSAMtype BAM SortedByCoordinate \ --outSAMattributes All \ --alignEndsType EndToEnd \ --outFileNamePrefix clip_ ``` ## Step 5: Alignment Filtering ```bash # Remove unmapped and low-quality reads samtools view -b -F 4 -q 10 clip_Aligned.sortedByCoord.out.bam > filtered.bam samtools index filtered.bam # Optional: remove reads mapping to rRNA/tRNA bedtools intersect -v -abam filtered.bam -b rrna_trna.bed > filtered_norRNA.bam ``` ## Step 6: PCR Deduplication ```bash # UMI-aware deduplication umi_tools dedup \ -I filtered.bam \ -S dedup.bam \ --output-stats=dedup_stats samtools index dedup.bam # Check deduplication rate echo "Duplication rate:" $(grep "Input Reads" dedup_stats.log | awk '{print $3}') ``` ## Step 7: Peak Calling ```bash # CLIPper (recommended) clipper -b dedup.bam -s hg38 -o peaks.bed --FDR 0.05 --superlocal # Alternative: Piranha Piranha -s dedup.bam -o piranha_peaks.bed -p 0.01 # For PAR-CLIP with T→C mutations PARalyzer settings.ini # Strand-specific calling samtools view -h -F 16 dedup.bam | samtools view -Sb - > plus.bam samtools view -h -f 16 dedup.bam | samtools view -Sb - > minus.bam clipper -b plus.bam -s hg38 -o peaks_plus.bed clipper -b minus.bam -s hg38 -o peaks_minus.bed cat peaks_plus.bed peaks_minus.bed | sort -k1,1 -k2,2n > peaks_stranded.bed ``` ## Step 8: Peak Annotation ```bash # Annotate with gene features bedtools intersect -a peaks.bed -b genes.gtf -wo > peaks_annotated.txt # Or use HOMER annotatePeaks.pl peaks.bed hg38 > peaks_homer_annotated.txt # Feature distribution awk -F'\t' '{print $8}' peaks_homer_annotated.txt | sort | uniq -c | sort -rn ``` ## Step 9: Motif Analysis ```bash # Extract peak sequences bedtools getfasta -fi genome.fa -bed peaks.bed -s -fo peaks.fa # HOMER motif finding (RNA mode) findMotifs.pl peaks.fa fasta motif_output -rna -len 5,6,7,8 -p 8 # MEME-ChIP meme-chip -oc meme_output -dna peaks.fa -meme-mod zoops -meme-nmotifs 10 ``` ## Step 10: Cross-link Site Analysis ```bash # For iCLIP/eCLIP: identify crosslink sites (read 5' ends) bedtools genomecov -ibam dedup.bam -bg -5 -strand + > crosslinks_plus.bg bedtools genomecov -ibam dedup.bam -bg -5 -strand - > crosslinks_minus.bg # For PAR-CLIP: identify T→C conversion sites # Requires specialized tools like PARpipe ``` ## Quality Checkpoints | Step | Metric | Expected | |------|--------|----------| | Raw | Read count | >10M | | Trimmed | Reads >20bp | >80% | | Aligned | Mapping rate | >50% | | Dedup | Unique rate | >20% | | Peaks | Peak count | 1,000-50,000 | | Peaks | Median width | 20-100 nt | | FRiP | Reads in peaks | >10% | ```bash # Calculate FRiP reads_in_peaks=$(bedtools intersect -a dedup.bam -b peaks.bed -u | samtools view -c -) total_reads=$(samtools view -c dedup.bam) frip=$(echo "scale=4; $reads_in_peaks / $total_reads" | bc) echo "FRiP: $frip" ``` ## Complete Pipeline Script ```bash #!/bin/bash set -euo pipefail SAMPLE=$1 READS=$2 GENOME_DIR=$3 GENOME_FA=$4 mkdir -p qc trimmed aligned peaks motifs # QC fastqc $READS -o qc/ # UMI extract umi_tools extract --stdin=$READS --bc-pattern=NNNNNNNNNN \ --stdout=trimmed/${SAMPLE}_extracted.fq.gz # Trim cutadapt -a AGATCGGAAGAGCACACGTCT --minimum-length 20 \ -o trimmed/${SAMPLE}_trimmed.fq.gz trimmed/${SAMPLE}_extracted.fq.gz # Align STAR --genomeDir $GENOME_DIR --readFilesIn trimmed/${SAMPLE}_trimmed.fq.gz \ --readFilesCommand zcat --outFilterMismatchNmax 2 --outFilterMultimapNmax 1 \ --outSAMtype BAM SortedByCoordinate --outFileNamePrefix aligned/${SAMPLE}_ # Filter and dedup samtools view -b -F 4 -q 10 aligned/${SAMPLE}_Aligned.sortedByCoord.out.bam | \ samtools sort -o aligned/${SAMPLE}_filtered.bam samtools index aligned/${SAMPLE}_filtered.bam umi_tools dedup -I aligned/${SAMPLE}_filtered.bam -S aligned/${SAMPLE}_dedup.bam samtools index aligned/${SAMPLE}_dedup.bam # Peaks clipper -b aligned/${SAMPLE}_dedup.bam -s hg38 -o peaks/${SAMPLE}_peaks.bed # Motifs bedtools getfasta -fi $GENOME_FA -bed peaks/${SAMPLE}_peaks.bed -s -fo peaks/${SAMPLE}.fa findMotifs.pl peaks/${SAMPLE}.fa fasta motifs/${SAMPLE} -rna -len 5,6,7 -p 4 echo "Pipeline complete for $SAMPLE" ``` ## Related Skills - clip-seq/clip-preprocessing - Detailed preprocessing - clip-seq/clip-alignment - Alignment optimization - clip-seq/clip-peak-calling - Peak caller comparison - clip-seq/binding-site-annotation - Feature annotation - clip-seq/clip-motif-analysis - Motif discovery
View on GitHub