القائمة
Deterministic sequence utilities for translation, ORFs, restriction sites, Kozak context, primer checks, and local FASTA record matching.
التثبيت باستخدام Codex أو Claude انسخ هذا Prompt والصقه في Codex أو Claude أو مساعد آخر ليراجع صفحة Skill ويثبّتها لك.
استنادا إلى تصنيف SOC المهني
Use this skill for genetics, genome source, variant, gene, phenotype, disease, screen, pharmacogenomics, and Genomi install/setup maintenance questions.
Build and inspect ClinVar exact-match evidence and candidate inventories. Use for clinical labels, VUS/conflict, carrier context, and drug-response rows.
Activate this skill for "/genomi decode", "decode my genome", "decode my DNA", "show me the dashboard", "the Genomi dashboard", "one-shot rundown", or any all-at-once request that asks Genomi to compose every capability's findings into a single artifact. This is the whole-genome dashboard kicker — it sweeps every relevant Genomi capability in one shot, not a per-target lookup. Composes evidence from every relevant Genomi capability into a single self-contained Genomi Dashboard.html and returns localhost serve metadata. Active genome required.
Answer drug-response, medication, PharmGKB-style, PGxDB, ATC, DrugBank, gene-drug, and variant-drug questions using public PGx evidence plus local sample genotype support when an Active Genome Index is selected.
Plan rare disease, hereditary disease, cancer risk, carrier-relevance, and observed-condition source investigation from public targets or selected active genome evidence.
Answer specific rsID, allele, gene, region, genotype, and absence/callability questions using explicit session context or public evidence.
| name | sequence |
| description | Deterministic sequence utilities for translation, ORFs, restriction sites, Kozak context, primer checks, and local FASTA record matching. |
| tools | ["sequence.analyze","sequence.match_reference","sequence.translate","sequence.find_orfs","sequence.find_restriction_sites","sequence.classify_kozak","sequence.check_primers"] |
| mutating | false |
Use this skill when the user supplies a DNA sequence and asks for ORFs, translation, restriction sites, Kozak context, primer checks, local FASTA record matching, or simple bench-style sequence QA.
sequence.analyze when more than one deterministic sequence fact may be
needed.sequence.match_reference when a local FASTA can identify the
supplied sequence before downstream reasoning.sequence.translate for frame/strand translation.sequence.find_orfs for ATG-to-stop ORF discovery.sequence.find_restriction_sites for common enzymes or custom motifs.sequence.classify_kozak for ATG start-context checks.sequence.check_primers for basic GC, Wallace Tm, self-complementarity,
and optional template amplicons.Examples:
sequence.translate with {"sequence":"ATGGCCATTGTAATGGGCCGCTGA","frame":1}sequence.find_orfs with {"sequence":"AAATGAAATAG","min_aa":1}sequence.find_restriction_sites with {"sequence":"GAATTCGGATCC","enzymes":["EcoRI","BamHI"]}sequence.match_reference with {"sequence":"ATGAAATAA","reference_fasta":"refs.fa"}Give the computed result and enough coordinates or frame details to make the answer auditable. Do not turn sequence utility output into medical or personal-genome interpretation.
A scope-limited result from this capability is not a final user-facing answer when other Genomi capabilities can contribute orthogonal evidence to the same question. Returning "cannot answer" while applicable capabilities remain unexamined is a host-agent failure mode.
Run a compact deterministic sequence analysis bundle and point to focused sequence tools when needed.
Use when: The user supplies DNA/RNA sequence text and may need translation, ORF, motif, Kozak, or local FASTA identity facts.
Why necessary: Supplied DNA strings need deterministic sequence utilities before any biological interpretation.
Example prompts: Translate this DNA sequence and find ORFs.
Result semantics: Computes deterministic sequence facts from supplied text and optional local FASTA reference matches; no external annotation is performed.
Check basic primer properties and optional template amplicons.
Use when: Checks primer GC, melting temperature, self-complementarity, and optional amplicon context.
Why necessary: Primer checks combine basic thermodynamic and amplicon facts that are not variant evidence.
Result semantics: Performs lightweight deterministic primer checks; it does not replace full primer-design thermodynamics.
Classify Kozak sequence context around ATG start codons.
Use when: Checks Kozak/start-codon context around a supplied DNA sequence position.
Why necessary: Start-codon context is a specialized expression-design check and should stay separate from general translation.
Result semantics: Uses the simple -3 A/G and +4 G Kozak rule; experimental expression strength needs separate evidence.
Find ATG-to-stop open reading frames in a supplied DNA sequence.
Use when: Finds open reading frames and coding-sequence candidates in a supplied DNA sequence.
Why necessary: ORF detection identifies candidate coding regions without relying on external annotation.
Result semantics: Finds simple ATG-to-stop ORFs from supplied sequence text; biological annotation requires separate source evidence.
Find common restriction enzyme or custom motif sites in a supplied DNA sequence.
Use when: Maps restriction enzyme sites and sequence motifs in a supplied DNA sequence.
Why necessary: Cloning and motif checks need exact site positions in the supplied sequence.
Result semantics: Reports motif positions in the supplied sequence; it does not model methylation or digestion conditions.
Match a supplied DNA sequence against local FASTA records and return record identifiers plus annotations.
Use when: The task supplies a DNA sequence and a local FASTA/reference set that can identify the sequence record before downstream reasoning.
Why necessary: Local FASTA matching identifies sequence records before downstream reasoning about that sequence.
Result semantics: Returns exact local FASTA record matches and header annotations; the host agent decides whether a matched record answers the question.
Translate a DNA sequence in a selected frame and strand using the standard genetic code.
Use when: Translates a supplied DNA sequence into codons or amino acids for the requested frame and strand.
Why necessary: Protein translation requires explicit frame and strand control rather than informal sequence reading.
Result semantics: Computes deterministic sequence facts from the supplied string only; no genome context or external IO is used.