| name | sequence-retrieval |
| description | ToolUniverse workflow — Sequence Retrieval |
| source | https://github.com/mims-harvard/ToolUniverse/tree/main/skills/tooluniverse-sequence-retrieval |
| metadata | null |
name: tooluniverse-sequence-retrieval
description: Retrieves biological sequences (DNA, RNA, protein) from NCBI and ENA with gene disambiguation, accession type handling, and comprehensive sequence profiles. Creates detailed reports with sequence metadata, cross-database references, and download options. Use when users need nucleotide sequences, protein sequences, genome data, or mention GenBank, RefSeq, EMBL accessions.
Biological Sequence Retrieval
Retrieve DNA, RNA, and protein sequences with proper disambiguation and cross-database handling.
IMPORTANT: Always use English terms in tool calls (gene names, organism names, sequence descriptions), even if the user writes in another language. Only try original-language terms as a fallback if English returns no results. Respond in the user's language.
Workflow Overview
Phase 0: Clarify (if needed)
↓
Phase 1: Disambiguate Gene/Organism
↓
Phase 2: Search & Retrieve (Internal)
↓
Phase 3: Report Sequence Profile
Phase 0: Clarification (When Needed)
Ask the user ONLY if:
- Gene name exists in multiple organisms (e.g., "BRCA1" → human or mouse?)
- Sequence type unclear (mRNA, genomic, protein?)
- Strain/isolate matters (e.g., E. coli → K-12, O157:H7, etc.)
Skip clarification for:
- Specific accession numbers (NC_, NM_, U*, etc.)
- Clear organism + gene combinations
- Complete genome requests with organism specified
Phase 1: Gene/Organism Disambiguation
1.1 Resolve Identifiers
from tooluniverse import ToolUniverse
tu = ToolUniverse()
tu.load_tools()
if user_provided_accession:
accession = user_provided_accession
elif user_provided_gene_and_organism:
result = tu.tools.NCBI_search_nucleotide(
operation="search",
organism=organism,
gene=gene,
limit=10
)
1.2 Accession Type Decision Tree
CRITICAL: Accession prefix determines which tools to use.
| Prefix | Type | Use With |
|---|
| NC_* | RefSeq chromosome | NCBI only |
| NM_* | RefSeq mRNA | NCBI only |
| NR_* | RefSeq ncRNA | NCBI only |
| NP_* | RefSeq protein | NCBI only |
| XM_* | RefSeq predicted mRNA | NCBI only |
| U*, M*, K*, X* | GenBank | NCBI or ENA |
| CP*, NZ_* | GenBank genome | NCBI or ENA |
| EMBL format | EMBL | ENA preferred |
1.3 Identity Resolution Checklist
Phase 2: Data Retrieval (Internal)
Retrieve silently. Do NOT narrate the search process.
2.1 Search for Sequences
result = tu.tools.NCBI_search_nucleotide(
operation="search",
organism=organism,
gene=gene,
strain=strain,
keywords=keywords,
seq_type=seq_type,
limit=10
)
accessions = tu.tools.NCBI_fetch_accessions(
operation="fetch_accession",
uids=result["data"]["uids"]
)
2.2 Retrieve Sequence Data
sequence = tu.tools.NCBI_get_sequence(
operation="fetch_sequence",
accession=accession,
format="fasta"
)
annotations = tu.tools.NCBI_get_sequence(
operation="fetch_sequence",
accession=accession,
format="genbank"
)
2.3 ENA Alternative (for GenBank/EMBL accessions)
if not accession.startswith(("NC_", "NM_", "NR_", "NP_", "XM_", "XR_")):
entry = tu.tools.ena_get_entry(accession=accession)
fasta = tu.tools.ena_get_sequence_fasta(accession=accession)
summary = tu.tools.ena_get_entry_summary(accession=accession)
Fallback Chains
| Primary | Fallback | Notes |
|---|
| NCBI_get_sequence | ENA (if GenBank format) | NCBI unavailable |
| ENA_get_entry | NCBI_get_sequence | ENA doesn't have RefSeq |
| NCBI_search_nucleotide | Try broader keywords | No results |
Critical Rule: Never try ENA tools with RefSeq accessions (NC_, NM_, etc.) - they will return 404 errors.
Phase 3: Report Sequence Profile
Output Structure
Present as a Sequence Profile Report. Hide search process.
# Sequence Profile: [Gene/Organism]
**Search Summary**
- Query: [gene] in [organism]
- Database: NCBI Nucleotide
- Results: [N] sequences found
---
## Primary Sequence
### [Accession]: [Definition/Title]
| Attribute | Value |
|-----------|-------|
| **Accession** | [accession] |
| **Type** | RefSeq / GenBank |
| **Organism** | [scientific name] |
| **Strain** | [strain if applicable] |
| **Length** | [X,XXX bp / aa] |
| **Molecule** | DNA / mRNA / Protein |
| **Topology** | Linear / Circular |
**Curation Level**: ●●● RefSeq (curated) / ●●○ GenBank (submitted) / ●○○ Third-party
### Sequence Statistics
| Statistic | Value |
|-----------|-------|
| **Length** | [X,XXX] bp |
| **GC Content** | [XX.X]% |
| **Genes** | [N] (if genome) |
| **CDS** | [N] (if annotated) |
### Sequence Preview
```fasta
>[accession] [definition]
ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGA
... [truncated, full sequence in download]
Annotations Summary (from GenBank format)
| Feature | Count | Examples |
|---|
| CDS | [N] | [gene names] |
| tRNA | [N] | - |
| rRNA | [N] | 16S, 23S |
| Regulatory | [N] | promoters |
Alternative Sequences
Ranked by relevance and curation level:
| Accession | Type | Length | Description | ENA Compatible |
|---|
| NC_000913.3 | RefSeq | 4.6 Mb | E. coli K-12 reference | ✗ |
| U00096.3 | GenBank | 4.6 Mb | E. coli K-12 | ✓ |
| CP001509.3 | GenBank | 4.6 Mb | E. coli DH10B | ✓ |
Cross-Database References
| Database | Accession | Link |
|---|
| RefSeq | [NC_*] | [NCBI link] |
| GenBank | [U*] | [NCBI link] |
| ENA/EMBL | [same as GenBank] | [ENA link] |
| BioProject | [PRJNA*] | [link] |
| BioSample | [SAMN*] | [link] |
Download Options
Formats Available
| Format | Description | Use Case |
|---|
| FASTA | Sequence only | BLAST, alignment |
| GenBank | Sequence + annotations | Gene analysis |
| GFF3 | Annotations only | Genome browsers |
Direct Commands
tu.tools.NCBI_get_sequence(
operation="fetch_sequence",
accession="[accession]",
format="fasta"
)
tu.tools.NCBI_get_sequence(
operation="fetch_sequence",
accession="[accession]",
format="genbank"
)
Related Sequences
Other Strains/Isolates
| Accession | Strain | Similarity | Notes |
|---|
| [acc1] | [strain1] | 99.9% | [notes] |
| [acc2] | [strain2] | 99.5% | [notes] |
Protein Products (if applicable)
| Protein Accession | Product Name | Length |
|---|
| [NP_*] | [protein name] | [X] aa |
Retrieved: [date]
Database: NCBI Nucleotide
---
## Curation Level Tiers
| Tier | Symbol | Accession Prefix | Description |
|------|--------|------------------|-------------|
| RefSeq Reference | ●●●● | NC_, NM_, NP_ | NCBI-curated, gold standard |
| RefSeq Predicted | ●●●○ | XM_, XP_, XR_ | Computationally predicted |
| GenBank Validated | ●●○○ | Various | Submitted, some curation |
| GenBank Direct | ●○○○ | Various | Direct submission |
| Third Party | ○○○○ | TPA_ | Third-party annotation |
Include in report:
```markdown
**Curation Level**: ●●●● RefSeq Reference
- Curated by NCBI RefSeq project
- Regular updates and validation
- Recommended for reference use
Completeness Checklist
Every sequence report MUST include:
Per Sequence (Required)
Search Summary (Required)
Include Even If Limited
Common Use Cases
Reference Genome
User: "Get E. coli K-12 complete genome"
result = tu.tools.NCBI_search_nucleotide(
operation="search",
organism="Escherichia coli",
strain="K-12",
seq_type="complete_genome",
limit=3
)
Gene Sequence
User: "Find human BRCA1 mRNA"
result = tu.tools.NCBI_search_nucleotide(
operation="search",
organism="Homo sapiens",
gene="BRCA1",
seq_type="mrna",
limit=10
)
Specific Accession
User: "Get sequence for NC_045512.2"
→ Direct retrieval with full metadata
Strain Comparison
User: "Compare E. coli K-12 and O157:H7 genomes"
→ Search both strains, provide comparison table
Error Handling
| Error | Response |
|---|
| "No search criteria provided" | Add organism, gene, or keywords |
| "ENA 404 error" | Accession is likely RefSeq → use NCBI only |
| "No results found" | Broaden search, check spelling, try synonyms |
| "Sequence too large" | Note size, provide download link instead of preview |
| "API rate limit" | Tools auto-retry; if persistent, wait briefly |
Tool Reference
NCBI Tools (All Accessions)
| Tool | Purpose |
|---|
NCBI_search_nucleotide | Search by gene/organism |
NCBI_fetch_accessions | Convert UIDs to accessions |
NCBI_get_sequence | Retrieve sequence data |
ENA Tools (GenBank/EMBL Only)
| Tool | Purpose |
|---|
ena_get_entry | Entry metadata |
ena_get_sequence_fasta | FASTA sequence |
ena_get_entry_summary | Summary info |
Search Parameters Reference
NCBI_search_nucleotide
| Parameter | Description | Example |
|---|
operation | Always "search" | "search" |
organism | Scientific name | "Homo sapiens" |
gene | Gene symbol | "BRCA1" |
strain | Specific strain | "K-12" |
keywords | Free text | "complete genome" |
seq_type | Sequence type | "complete_genome", "mrna", "refseq" |
limit | Max results | 10 |
NCBI_get_sequence
| Parameter | Description | Example |
|---|
operation | Always "fetch_sequence" | "fetch_sequence" |
accession | Accession number | "NC_000913.3" |
format | Output format | "fasta", "genbank" |