القائمة
Predicts potential off-target sites for a given sgRNA sequence using mismatch analysis.
يُحدَّد Prompt الذي يراجع المصدر أولًا بشكل افتراضي. يمكنك التبديل إلى أمر مباشر أو تنزيل نسخة محلية.
اقرأ SKILL.md وأي ملفات مرافقة يعرضها SkillsMP قبل أن تقرر التثبيت.
التثبيت باستخدام Codex أو Claude انسخ هذا Prompt والصقه في Codex أو Claude أو مساعد آخر ليراجع صفحة Skill ويثبّتها لك.
يتجاوز الأمر المباشر Prompt المخصّص للمراجعة. افحص المصدر قبل تشغيله.
npx skills add https://github.com/swaruplab/operon --skill crispr-offtarget-predictorيبقى الأمر في سطر واحد. مرّر أفقيًا لمراجعته كاملًا قبل النسخ.
تفضّل نسخة محلية؟ نزّل الملفات المتاحة حاليًا لدى SkillsMP.
Install and run the BD Rhapsody™ Sequence Analysis Pipeline (v3.0) on a shared cluster or remote Linux server with no root and no container runtime. Covers the self-contained install bundle, reference archives, FASTQ manifests, per-library YML generation, SLURM array execution, outputs, sample-tag demultiplexing, and the failure modes that cost hours — wrong Sample_Tags_Version on nuclei runs, uncapped Maximum_Threads, node-local scratch, and pinning a stale `latest` bundle.
Advanced single-cell multi-omics analysis including scRNA-seq, scCITE-seq, scATAC-seq, and TARGET-seq. Use when analyzing single-cell data, cell type identification, trajectory analysis, differential expression, UMAP/clustering, integrating protein and RNA modalities (TotalVI), or working with Scanpy, Seurat, scvi-tools. Includes workflows for MPN, hematologic malignancies, megakaryocyte biology.
Detects differential alternative splicing between conditions using rMATS-turbo (binomial LRT on junction counts), leafcutter (Dirichlet-multinomial GLM on intron clusters), MAJIQ V3 deltapsi/HET (Bayesian posterior on LSVs), SUPPA2 (empirical-null on TPM-derived PSI), or Shiba (junction-imbalance-corrected, 2025 SOTA at low coverage). Reports FDR-corrected significance and delta PSI effect sizes. Tools differ in statistical model, annotation dependence, calibration regime, and replicate-count requirements. Use when comparing splicing patterns between treatment groups, tissues, or disease states.
استنادا إلى تصنيف SOC المهني
عرض SKILL.md
| name | crispr-offtarget-predictor |
| description | Predicts potential off-target sites for a given sgRNA sequence using mismatch analysis. |
| measurable_outcome | Execute skill workflow successfully with valid output within 15 minutes. |
| allowed-tools | ["read_file","run_shell_command"] |
This skill identifies potential off-target binding sites for a specific sgRNA sequence. It helps researchers assess the specificity of their CRISPR design.
User: "Check sgRNA 'GAGTCCGAGCAGAAGAAGAA' for off-targets."
Agent Action:
python3 Skills/Genomics/CRISPR_Prediction/impl.py --sequence GAGTCCGAGCAGAAGAAGAA --pam NGG