| name | bio-crispr-screens-mageck-analysis |
| description | Analyzes pooled CRISPR screens with MAGeCK (Li et al 2014), covering count generation (mageck count), the RRA two-condition workflow (mageck test using alpha-RRA over per-sgRNA negative-binomial p-values), the MLE multi-condition workflow (mageck mle with explicit design matrix and beta-score output), normalization choice (median vs total vs control-sgRNA vs spike-in), sgRNA efficiency injection, paired-sample testing, time-course design, drug-screen versus dropout-screen design matrices, MAGeCKFlute and MAGeCK-VISPR downstream visualization, and decision logic for when to use MAGeCK vs JACKS / BAGEL2 / drugZ / Chronos. Use when running a fresh CRISPR screen analysis, picking RRA vs MLE for the experimental design, choosing a normalization method from QC signatures, debugging MLE convergence failure or NaN beta scores, comparing MAGeCK output across tools, or building a batch-aware multi-cell-line / multi-condition MLE design matrix. |
| tool_type | cli |
| primary_tool | MAGeCK |
Version Compatibility
Reference examples tested with: MAGeCK 0.5.9+, MAGeCKFlute 2.0+ (R/Bioconductor), MAGeCK-VISPR 0.5.6+, pandas 2.2+, numpy 1.26+, matplotlib 3.8+.
Before using code patterns, verify installed versions match. If versions differ:
- CLI:
mageck --version, mageck count --help, mageck test --help, mageck mle --help
- R:
packageVersion('MAGeCKFlute'), ?FluteRRA, ?FluteMLE
If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.
MAGeCK CRISPR Screen Analysis
"Run MAGeCK on my pooled CRISPR screen" -> Count sgRNAs from FASTQ, normalize across samples, and rank genes by enrichment or depletion using either the robust rank aggregation (RRA) test for two-condition designs or the maximum-likelihood (MLE) model with explicit design matrix for multi-condition / time-course / drug screens.
- CLI:
mageck count -> mageck test for two-condition RRA
- CLI:
mageck mle for multi-condition / time-course / multi-cell-line MLE
- R:
MAGeCKFlute::FluteRRA() / FluteMLE() for downstream visualization and pathway analysis
- Python:
mageck-vispr for interactive QC + result dashboard
RRA vs MLE Decision Tree
| Experimental design | Recommended | Why |
|---|
| Two conditions (e.g. drug vs vehicle, treated vs untreated), single cell line, no covariates | mageck test (RRA) | RRA is more robust to outlier sgRNAs; faster; default for most published screens |
| Time series (Day 0 -> Day 7 -> Day 14 -> Day 21) | mageck mle | RRA cannot model multiple timepoints jointly; MLE estimates per-condition beta scores |
| Multi-cell-line panel (e.g. DepMap-style 5-50 lines) | mageck mle with cell-line covariate, or Chronos | MLE handles >2 conditions; Chronos preferred at DepMap scale |
| Paired samples (each replicate matched donor/cell prep) | mageck mle with paired design | RRA does not support pairing |
| Combinatorial (treatment x cell line x time) | mageck mle with full factorial design | RRA only handles 1 factor |
| Drug screen (vehicle vs drug, multiple doses) | mageck mle with dose covariate OR drugZ (preferred for chemogenomic) | drugZ optimized for chemogenomic; see [[drugz-chemogenomic]] |
| Essentiality (Day 0 -> endpoint, single condition) | mageck test for simple dropout; mageck mle if multi-cell-line | RRA suffices; or BAGEL2 for Bayesian essentiality; see [[bagel-essentiality]] |
| Multi-batch / multi-screen joint analysis | mageck mle with batch covariate, JACKS for guide efficacy, or Chronos | See [[batch-correction]] |
Fails when:
- Using RRA for time-series and treating each timepoint as a separate test: false-discovery inflation from un-modeled temporal correlation. Use MLE.
- Using MLE without explicit design matrix in a screen with severe batch effects: beta scores include batch variance. Add batch covariate.
- Using MAGeCK for drug screens without vehicle control: comparing drug vs Day 0 conflates drug effect with proliferation. Compare drug vs vehicle, not Day 0. See [[drugz-chemogenomic]].
The RRA Algorithm (under the hood)
Why this matters for postdoc-level use: RRA is not "non-parametric"; it tests whether per-gene sgRNA p-value ranks are more clustered toward the extremes than expected under the uniform null. The chain:
mageck count normalizes raw counts (median by default) and outputs *.count_normalized.txt.
mageck test computes a per-sgRNA p-value under a NB model fitted to per-gene variance (mean-variance trend stabilized via empirical Bayes shrinkage; same family as edgeR/DESeq2 but simpler dispersion estimation).
- Per-sgRNA p-values are ranked; ranks are normalized to percentile (rho).
- For each gene with k sgRNAs, the alpha-RRA score is the minimum over
Pr(beta(i, k-i+1) <= rho_i) for i in 1..k -- the probability of observing the i-th smallest rank in a uniform sample.
- Gene-level p-value is computed by permuting sgRNA-to-gene assignment to derive an empirical null over alpha-RRA scores.
- Multiple-testing correction is Benjamini-Hochberg.
Critical assumption: RRA assumes most sgRNAs are non-changing (used to estimate the NB dispersion). If >40% of sgRNAs change, median normalization fails and the dispersion estimate is biased. Symptom: every gene appears significant. Fix: use control-sgRNA normalization (--norm-method control) with non-targeting controls as the reference.
The MLE Model (under the hood)
Why this matters: MLE assumes the per-sgRNA log-count is Negative-Binomial with mean determined by a linear combination of condition betas plus an sgRNA-efficiency term (if supplied). The chain:
- Define a design matrix where rows are samples and columns are conditions; entries are 1 if the sample belongs to the condition, 0 otherwise. A baseline column (all 1s) is required.
- Per-gene, the model is
log(count_ij) = baseline_i + sum_c (beta_gc * design_jc) + log(sgrna_efficiency_i) + log(size_factor_j) where i is sgRNA, j is sample, c is condition.
- The optimizer finds the per-gene beta_gc maximizing the NB likelihood; per-gene Wald-statistic gives a p-value per condition.
- Each beta represents the log-fold-change in that condition relative to baseline, accounting for sgRNA efficiency.
Critical assumption: Beta scores are interpretable only when the design matrix is correctly specified. A common error is omitting batch as a covariate -- the resulting betas absorb batch variance. The fix is to add batch columns; the betas then estimate biology after batch adjustment.
Convergence failure: MLE NaN beta scores indicate optimizer divergence -- usually because a gene has too few sgRNAs with non-zero counts in the relevant conditions. The output includes such genes with NaN; do not interpret them as zero effect.
Count sgRNAs from FASTQ
Goal: Quantify sgRNA representation from raw sequencing data.
Approach: Run mageck count to map FASTQ reads to the sgRNA library reference, producing a normalized count matrix and QC summary. Set --norm-method median (default; robust to outliers) or --norm-method control (when many sgRNAs change).
mageck count \
--list-seq library.csv \
--sample-label Plasmid,Day0,Veh_r1,Veh_r2,Drug_r1,Drug_r2 \
--fastq Plasmid.fq.gz Day0.fq.gz Veh_r1.fq.gz Veh_r2.fq.gz Drug_r1.fq.gz Drug_r2.fq.gz \
--norm-method median \
--output-prefix screen \
--trim-5 AUTO
Library file format (tab- or comma-separated; first row is header):
sgRNA,Sequence,Gene
BRCA1_1,ATGGATTTATCTGCTCTTCG,BRCA1
BRCA1_2,CAGCAGATACTTGATGCATC,BRCA1
NTC_0001,GACGCATCGAATCAATAGCC,NonTargeting_0001
Normalization Decision
--norm-method | When to use | Mechanism | Fails when |
|---|
median (default) | Standard screen, <40% guides change | Scale each sample to a common median of all guides | Heavy selection (>40% guides change) inflates median, biasing scaling |
total | Equal sequencing depth assumed, no outliers | Scale to total reads | Sensitive to PCR jackpots / outlier high-count guides |
none | Already-normalized inputs (DEPRECATED for raw FASTQ counting) | Skips scaling | Almost never appropriate; only for already-normalized inputs |
control | Heavy selection screens; library has ≥500 NTCs | Scale each sample so non-targeting controls have constant median | Requires --control-sgrna ntcs.txt listing NTC sgRNAs |
Diagnostic: Run with median first. If essentialome PR-AUC against CEGv2 is high and Gini is in range, accept. If PR-AUC <0.5 despite reasonable Gini, retry with control -- this isolates whether median normalization was masking the signal.
MAGeCK Test (RRA for Two-Condition)
Goal: Identify genes significantly enriched or depleted between treatment and control.
Approach: Compute per-sgRNA NB-model p-values, rank, apply alpha-RRA to get per-gene scores, permute for gene-level FDR. Outputs separate columns for positive and negative selection.
mageck test \
--count-table screen.count.txt \
--treatment-id Drug_r1,Drug_r2 \
--control-id Veh_r1,Veh_r2 \
--norm-method median \
--output-prefix drug_vs_veh \
--gene-lfc-method median \
--sort-criteria pos
Gene-summary columns:
| Column | Meaning |
|---|
id | Gene symbol |
num | Number of sgRNAs in library for this gene |
| `neg | score, pos |
| `neg | p-value, pos |
| `neg | fdr, pos |
| `neg | rank, pos |
| `neg | lfc, pos |
Interpretation rule: A gene is a strong essential if neg|fdr < 0.05 AND neg|lfc < -1. A gene is a strong resistance hit if pos|fdr < 0.05 AND pos|lfc > 1. Genes with fdr < 0.05 but |lfc| < 0.5 are statistically significant but biologically weak -- worth flagging for orthogonal validation.
MAGeCK MLE (Multi-Condition)
Goal: Estimate gene effects across complex experimental designs with multiple conditions, time points, batches, or covariates.
Approach: Specify a design matrix mapping samples to conditions, then run mageck mle which fits a NB GLM with sgRNA-efficiency term and outputs per-gene per-condition beta scores.
cat > design.txt <<EOF
Samples baseline day7 day14 day21
Day0 1 0 0 0
Day7_r1 1 1 0 0
Day7_r2 1 1 0 0
Day14_r1 1 0 1 0
Day14_r2 1 0 1 0
Day21_r1 1 0 0 1
Day21_r2 1 0 0 1
EOF
mageck mle \
--count-table screen.count.txt \
--design-matrix design.txt \
--output-prefix timecourse_mle \
--norm-method median \
--sgrna-efficiency efficiency.txt \
--sgrna-eff-name-column 0 \
--sgrna-eff-score-column 1 \
--max-sgrnapergene-permutation 40
Gene-summary columns (MLE):
| Column | Meaning |
|---|
Gene | Gene symbol |
sgRNA | Number of sgRNAs |
| ` | beta` |
| ` | z` |
| ` | p-value` |
| ` | fdr` |
| ` | wald-fdr` |
Interpretation rule: Beta scores are log2-fold-changes; a beta of -1 in condition day21 means sgRNAs are 2-fold depleted in day-21 relative to baseline. NaN betas indicate convergence failure (typically a gene with too few non-zero counts in that condition); exclude from interpretation.
Sample MAGeCK Test for Drug Screen with sgRNA Efficiency
mageck test \
--count-table screen.count.txt \
--treatment-id Drug_r1,Drug_r2,Drug_r3 \
--control-id Veh_r1,Veh_r2,Veh_r3 \
--norm-method control \
--control-sgrna ntcs.txt \
--gene-lfc-method median \
--variance-estimation-samples Day0_r1,Day0_r2 \
--output-prefix drug_screen_normalized
Reading order: Run mageck count -> screen-qc skill for QC -> mageck test or mageck mle -> MAGeCKFlute for visualization -> downstream pathway analysis.
Time-Course Analysis
Goal: Identify genes with consistent depletion or enrichment across multiple time points.
Approach: Run mageck mle with a design matrix where each timepoint is a separate column, then test for monotonic trends in per-condition beta scores.
import pandas as pd
import numpy as np
def time_course_consistency(mle_results, conditions=['day7', 'day14', 'day21']):
'''Identify genes with monotonic beta trends across timepoints.
Returns genes where all betas same sign and trend is monotone.'''
beta_cols = [f'{c}|beta' for c in conditions]
fdr_cols = [f'{c}|fdr' for c in conditions]
df = mle_results[['Gene'] + beta_cols + fdr_cols].copy()
df['all_negative'] = (df[beta_cols] < 0).all(axis=1)
df['all_positive'] = (df[beta_cols] > 0).all(axis=1)
df['monotone'] = df[beta_cols].apply(lambda x: (np.diff(x) <= 0).all() or (np.diff(x) >= 0).all(), axis=1)
df['any_sig'] = (df[fdr_cols] < 0.05).any(axis=1)
return df[df['monotone'] & df['any_sig']].sort_values(beta_cols[-1])
Visualizing Results
Goal: Generate publication-grade volcano plot and rank plot of MAGeCK output.
Approach: Load gene_summary.txt, plot -log10(fdr) vs LFC, color by significance, annotate top hits.
import matplotlib.pyplot as plt
import numpy as np
def volcano(gene_summary_path, direction='neg', fdr_threshold=0.05, lfc_threshold=1.0):
'''direction: "neg" for dropout, "pos" for enrichment.'''
df = pd.read_csv(gene_summary_path, sep='\t')
lfc_col = f'{direction}|lfc'
fdr_col = f'{direction}|fdr'
fig, ax = plt.subplots(figsize=(9, 7))
sig = (df[fdr_col] < fdr_threshold) & (np.abs(df[lfc_col]) > lfc_threshold)
ax.scatter(df.loc[~sig, lfc_col], -np.log10(df.loc[~sig, fdr_col].clip(lower=1e-10)),
c='lightgray', alpha=0.4, s=10)
ax.scatter(df.loc[sig, lfc_col], -np.log10(df.loc[sig, fdr_col].clip(lower=1e-10)),
c='red' if direction == 'neg' else 'blue', alpha=0.7, s=18)
top = df.loc[sig].nsmallest(15, fdr_col)
for _, r in top.iterrows():
ax.annotate(r['id'], (r[lfc_col], -np.log10(max(r[fdr_col], 1e-10))), fontsize=7)
ax.axhline(-np.log10(fdr_threshold), ls='--', c='black', lw=0.5)
ax.axvline(0, c='gray', lw=0.5)
ax.set_xlabel(f' LFC')
ax.set_ylabel()
fig
MAGeCKFlute Integration (R)
Goal: Use the canonical pathway-analysis dashboard for downstream visualization.
Approach: Load MAGeCK output in R, run FluteRRA or FluteMLE, which produces volcano, rank, square-plot, and KEGG/Reactome enrichment.
library(MAGeCKFlute)
FluteRRA(gene_summary = "drug_vs_veh.gene_summary.txt",
sgrna_summary = "drug_vs_veh.sgrna_summary.txt",
organism = "hsa",
outdir = "flute_output/")
FluteMLE(gene_summary = "timecourse_mle.gene_summary.txt",
treatname = "day21", ctrlname = "baseline",
organism = "hsa",
outdir = "flute_mle_output/")
MAGeCK-VISPR Interactive Dashboard
mageck-vispr init my_screen
snakemake --cores 8
vispr server results/*.vispr.yaml
Failure Modes
NaN beta scores in MLE output
Trigger: A gene has fewer than 2 non-zero-count sgRNAs in the relevant condition.
Mechanism: MLE optimizer cannot fit beta when likelihood is flat (insufficient evidence).
Symptom: mle.gene_summary.txt shows NaN in specific gene-condition cells.
Fix: Filter these genes from downstream interpretation; they are not "zero effect" but undetermined. If many genes show NaN, the screen depth is too low or many guides have failed -- audit with screen-qc.
Every gene appears significant after RRA
Trigger: >40% of sgRNAs change direction (heavy selection screen).
Mechanism: Median normalization assumes most guides are non-changing; under heavy selection, median is biased and dispersion estimation breaks.
Symptom: Thousands of "hits" at FDR <0.05; volcano plot looks like a U with no separation.
Fix: Switch to --norm-method control with non-targeting controls; or use BAGEL2 / Chronos for essentiality analysis (mageck is not designed for screens with high-fraction true essentiality).
MLE beta absorbs batch variance
Trigger: Multi-batch screen run without explicit batch covariate in design matrix.
Mechanism: Without a batch column, beta_condition includes both biological signal and batch difference between conditions.
Symptom: Beta scores differ between batches for the same biological condition; PCA shows samples cluster by batch not condition.
Fix: Add batch covariate columns to design matrix (e.g., one column per batch indicator); the biological betas are then estimated after batch adjustment. See [[batch-correction]].
sgRNA-efficiency injection makes scores worse
Trigger: Supplied JACKS efficiency scores from a different cell line / chemistry than the current screen.
Mechanism: sgRNA efficacy is cell-line and modality dependent; HEK293T efficiency is not HCT116 efficiency; Cas9 efficiency is not CRISPRi efficiency.
Symptom: Some genes that were hits without efficiency become non-significant with efficiency.
Fix: Use efficiency derived from JACKS run on the matching cell line / library / chemistry, or use no efficiency (treat all sgRNAs as equal).
Lack of cell-line covariate in multi-line screen
Trigger: Running mageck mle on multiple cell lines without a cell-line indicator column.
Mechanism: Each cell line has different essentiality profile; combining without indicator pools variance and dilutes per-line signal.
Symptom: Per-line known essentials don't show up; results look like a meta-analysis without effect sizes.
Fix: Add cell-line indicator columns; or move to Chronos which models cell-line and screen-quality jointly (see [[hit-calling]]).
Reconciliation: When MAGeCK Disagrees With Other Tools
| Pattern | Likely cause | Action |
|---|
| MAGeCK FDR significant, BAGEL2 Bayes factor not | Different reference set; BAGEL2 trained on CEGv2/NEGv1 | Trust BAGEL2 for essentiality calling; MAGeCK for general LFC |
| MAGeCK significant, JACKS not | JACKS down-weighted noisy guides; MAGeCK trusts all 4 | Inspect per-sgRNA scores; if one sgRNA dominates, JACKS is right |
| MAGeCK and Chronos agree at top 100; disagree at 100-300 | Chronos accounts for CN and screen quality; MAGeCK does not | Trust Chronos for cancer-line screens; MAGeCK lacks CN correction |
| MAGeCK significant, drugZ not | drugZ uses bidirectional Z; MAGeCK uses RRA | For chemogenomic, trust drugZ (vehicle-anchored) |
| RRA and MLE disagree on same data | RRA more robust to outliers; MLE more sensitive | Higher-ranked hits in both = high confidence; only-one-method = orthogonal validate |
Quantitative Thresholds
| Threshold | Value | Source / Rationale |
|---|
| Hit FDR (gene-level) | <0.05 | MAGeCK paper Li 2014; standard |
| Hit LFC magnitude | >1 (2-fold) | Biologically interpretable effect size; FDR-only hits at low LFC need validation |
| Normalization fraction-changing threshold | <40% guides change for median norm | Median-normalization assumption (most guides unchanged) |
| sgRNAs needed for reliable MLE | ≥3 per gene with non-zero counts in each condition | MAGeCK 0.5+ behavior; below this, NaN |
| Time-course conditions for MLE | ≥3 (otherwise use test) | MLE statistical power |
| PR-AUC of ranked hits against CEGv2 | >0.7 for "passing" essentiality screen | Community convention (CEGv2 from Hart 2017); see [[screen-qc]] |
| RRA permutation passes per gene | 100 default; raise via --additional-rra-parameters "--permutation N" | Not exposed directly on mageck test; trades runtime |
Common Errors
| Error / symptom | Cause | Solution |
|---|
mageck count outputs mostly zero counts | Library column order swapped, or wrong --trim-5 length | Library must be sgRNA id, sequence, gene; try --trim-5 AUTO |
| All genes significant | Median normalization break (heavy selection) | --norm-method control |
| NaN beta in MLE | Gene with insufficient non-zero counts | Exclude from interpretation |
| Two-condition MLE works but ranks differ from RRA | Different test statistic | Both correct; check direction and use the appropriate one |
| Hits include amplified genes | No CN correction | See [[copy-number-correction]] |
| Library not detected in screen.countsummary.txt | Library file format wrong | Check column order is sgRNA id, sequence, gene (no spaces) |
References
- Li W et al. 2014. Genome Biol 15:554. MAGeCK; original alpha-RRA algorithm.
- Li W et al. 2015. Genome Biol 16:281. MAGeCK-VISPR; QC + visualization.
- Wang B et al. 2019. Nat Protoc 14:756. MAGeCKFlute pathway analysis.
- Joung J et al. 2017. Nat Protoc 12:828. Screen protocol.
- Hart T et al. 2017. G3 7:2719. CEGv2/NEGv1 reference sets for benchmarking.
Related Skills
- crispr-screens/screen-qc - Pre-MAGeCK QC; gates whether to use median or control normalization
- crispr-screens/jacks-analysis - Joint efficacy + essentiality; alternative to MLE
- crispr-screens/bagel-essentiality - BAGEL2 Bayes-factor calling; alternative for essentiality
- crispr-screens/drugz-chemogenomic - drugZ for chemogenomic screens; alternative for drug screens
- crispr-screens/hit-calling - Cross-method decision tree
- crispr-screens/copy-number-correction - CRISPRcleanR / Chronos for cancer-line CN correction
- crispr-screens/batch-correction - Multi-batch design-matrix construction
- pathway-analysis/gsea - Downstream GSEA on ranked hits
- pathway-analysis/go-enrichment - GO enrichment of hit lists