| name | bio-motif-search |
| description | Find patterns, motifs, and subsequences in biological sequences using Biopython. Use when searching for transcription factor binding sites, regulatory elements, or any sequence pattern. For restriction enzyme analysis, use the restriction-analysis skill. |
| tool_type | python |
| primary_tool | Bio.motifs |
Motif Search
Find patterns and motifs in biological sequences using Biopython and regex.
Required Imports
from Bio.Seq import Seq
from Bio import motifs
import re
Core Methods
find() - First Occurrence
seq = Seq('ATGCGAATTCGATCGAATTCGATC')
pos = seq.find('GAATTC')
Returns -1 if not found.
count() - Count Occurrences
seq = Seq('ATGCGAATTCGATCGAATTCGATC')
n = seq.count('GAATTC')
find() with Start Position
seq = Seq('ATGCGAATTCGATCGAATTCGATC')
first = seq.find('GAATTC')
second = seq.find('GAATTC', 5)
Code Patterns
Find All Occurrences
def find_all(seq, pattern):
pattern = str(pattern)
seq_str = str(seq)
positions = []
pos = seq_str.find(pattern)
while pos != -1:
positions.append(pos)
pos = seq_str.find(pattern, pos + 1)
return positions
seq = Seq('ATGCGAATTCGATCGAATTCGATC')
positions = find_all(seq, 'GAATTC')
Search Both Strands
def find_both_strands(seq, pattern):
results = []
for pos in find_all(seq, pattern):
results.append(('+', pos))
rc = seq.reverse_complement()
for pos in find_all(rc, pattern):
results.append(('-', len(seq) - pos - len(pattern)))
return results
Regex Pattern Search
For ambiguous or flexible patterns:
def regex_search(seq, pattern):
seq_str = str(seq)
return [(m.start(), m.group()) for m in re.finditer(pattern, seq_str)]
matches = regex_search(seq, 'ATG')
matches = regex_search(seq, 'TATA[AT]A[AT]')
IUPAC Ambiguity Pattern
IUPAC_DNA = {
'R': '[AG]', 'Y': '[CT]', 'S': '[GC]', 'W': '[AT]',
'K': '[GT]', 'M': '[AC]', 'B': '[CGT]', 'D': '[AGT]',
'H': '[ACT]', 'V': '[ACG]', 'N': '[ACGT]'
}
def iupac_to_regex(pattern):
regex = ''
for char in pattern:
regex += IUPAC_DNA.get(char, char)
return regex
pattern = 'GATNNTC'
regex = iupac_to_regex(pattern)
matches = regex_search(seq, regex)
Find ORFs (Start to Stop)
def find_orfs(seq, start='ATG', stops=['TAA', 'TAG', 'TGA'], min_length=30):
seq_str = str(seq)
orfs = []
start_positions = find_all(seq, start)
for start_pos in start_positions:
for frame_offset in range(3):
if (start_pos - frame_offset) % 3 == 0:
for stop in stops:
stop_pos = start_pos + 3
while stop_pos <= len(seq) - 3:
codon = seq_str[stop_pos:stop_pos + 3]
if codon == stop:
if stop_pos - start_pos >= min_length:
orfs.append((start_pos, stop_pos + 3, seq[start_pos:stop_pos + 3]))
break
stop_pos += 3
break
return orfs
Find Repeats
def find_tandem_repeats(seq, unit_length, min_copies=2):
seq_str = str(seq)
repeats = []
for i in range(len(seq) - unit_length * min_copies + 1):
unit = seq_str[i:i + unit_length]
copies = 1
pos = i + unit_length
while pos <= len(seq) - unit_length and seq_str[pos:pos + unit_length] == unit:
copies += 1
pos += unit_length
if copies >= min_copies:
repeats.append((i, unit, copies))
return repeats
seq = Seq('ATGCAGCAGCAGCAGTTT')
repeats = find_tandem_repeats(seq, 3, 2)
Bio.motifs Module
Create Motif from Instances
from Bio import motifs
from Bio.Seq import Seq
instances = [Seq('TACAA'), Seq('TACGA'), Seq('TACTA'), Seq('TGCAA')]
m = motifs.create(instances)
Motif Properties
m.consensus
m.degenerate_consensus
m.anticonsensus
m.counts
pwm = m.counts.normalize(pseudocounts=0.5)
pssm = pwm.log_odds()
Information Content
pwm = m.counts.normalize(pseudocounts=0.5)
pssm = pwm.log_odds()
mean_ic = pssm.mean()
max_score = pssm.max
min_score = pssm.min
print(f'Mean IC: {mean_ic:.3f} bits')
print(f'Max score: {max_score:.3f}')
print(f'Min score: {min_score:.3f}')
PSSM Search
seq = Seq('ATGCTACAAGCTACGATACTA')
for position, score in pssm.search(seq, threshold=3.0):
match = seq[position:position + len(m.consensus)]
print(f'Position {position}: {match} (score: {score:.2f})')
for position, score in pssm.search(seq, threshold=3.0, both=True):
print(f'Position {position}: score {score:.2f}')
Calculate Threshold from Distribution
sd = pssm.distribution()
threshold = sd.threshold_fpr(0.01)
threshold = sd.threshold_fnr(0.1)
threshold = sd.threshold_balanced(1000)
Reading Motif Files
JASPAR Format
from Bio import motifs
with open('motif.jaspar') as f:
m = motifs.read(f, 'jaspar')
print(f'Name: {m.name}')
print(f'Matrix ID: {m.matrix_id}')
print(m.counts)
MEME Format
with open('meme.txt') as f:
record = motifs.parse(f, 'meme')
for m in record:
print(f'{m.name}: {m.consensus}')
TRANSFAC Format
with open('motif.transfac') as f:
record = motifs.parse(f, 'transfac')
for m in record:
print(f'{m.name}: {m.consensus}')
Write Motifs
with open('output.jaspar', 'w') as f:
f.write(m.format('jaspar'))
with open('output.transfac', 'w') as f:
f.write(m.format('transfac'))
Common Motif Patterns
| Motif | Pattern | Description |
|---|
| Start codon | ATG | Translation initiation |
| Stop codons | TAA|TAG|TGA | Translation termination |
| Kozak | [AG]CCATGG | Eukaryotic translation initiation |
| TATA box | TATA[AT]A[AT] | Promoter element |
| GC box | GGGCGG | Promoter element (Sp1) |
| CAAT box | CCAAT | Promoter element |
| Poly-A signal | AATAAA | mRNA polyadenylation |
| E-box | CA[ACGT]{2}TG | bHLH TF binding |
| CpG island | High CG density | Promoter regions |
Common Errors
| Error | Cause | Solution |
|---|
| No matches found | Case mismatch | Use .upper() on both |
| Missing matches | Pattern on opposite strand | Search reverse complement too |
TypeError | Mixing Seq and string | Use str() conversion |
ValueError parsing motif | Wrong format specified | Check file format |
Decision Tree
Need to find patterns in sequence?
├── Exact match?
│ ├── Just need position of first? → seq.find()
│ ├── Need count? → seq.count()
│ └── Need all positions? → loop with find()
├── Fuzzy/ambiguous pattern?
│ └── Use regex with re.finditer()
├── IUPAC pattern?
│ └── Convert to regex, then search
├── Both strands?
│ └── Search original and reverse_complement
├── Probabilistic (PWM/PSSM)?
│ └── Use Bio.motifs
│ ├── Create from instances → motifs.create()
│ ├── Read from file → motifs.read() / parse()
│ ├── Get consensus → m.consensus, m.degenerate_consensus
│ ├── Search sequence → pssm.search()
│ └── Calculate threshold → distribution.threshold_fpr()
└── Restriction sites?
└── Use restriction-analysis skill (Bio.Restriction)
Related Skills
- seq-objects - Create Seq objects for searching
- reverse-complement - Search both strands for motifs
- sequence-io/filter-sequences - Filter sequences that contain specific motifs
- restriction-analysis/restriction-sites - For restriction enzyme site searching
- database-access - Download motif databases from NCBI/JASPAR