tooluniverse-molecular-cloning

# Molecular Cloning Assembly Design (Gibson & Golden Gate) Plan how to join DNA fragments into a construct: design the **overlaps** (Gibson) or **Type IIS overhangs** (Golden Gate) and avoid the failures that come from internal sites and non-unique junctions. ## Step 0 — Pick the method | Use **Gibson Assembly** when | Use **Golden Gate** when | |---|---| | A few fragments, **scarless/seamless** junctions anywhere you choose | Many parts, **standardized reusable** parts (MoClo/modular), one-pot | | You can add ~20–40 bp homology by PCR | You can remove internal BsaI/BbsI sites (domestication) | | One-off constructs | Combinatorial libraries / repeated assemblies | Both are sequence-independent (no scar at the junction for Gibson; a 4-bp fusion scar for Golden Gate). For 2–4 unique fragments, Gibson is usually simplest; for libraries or a parts toolkit, Golden Gate. ## Step 1 — Gibson Assembly ```bash tu run DNA_gibson_design '{"operation":"gibson_design", "fragments":["ATGGCG...GAGGAC","GAGGAC...GGCAAG","GGGCAAG...ATCCT"], "overlap_length":20}' ``` For each fragment it returns `left_overlap`, `right_overlap`, and `with_overlaps` (the fragment extended with the homology arms you'd add to your PCR primers — hand these to `tooluniverse-primer-design`). **Gibson design rules** - **Overlap length 15–40 bp** (20–25 typical); longer for GC-poor junctions. - **Overlap Tm ≈ 48–65 °C** and balanced between junctions. - **Fragment order matters** — list fragments in assembly order; the last fragment's 3′ overlaps the first only if you're making a circle (vector). - **Avoid repeats/secondary structure** at the junctions (hairpins, direct repeats) → misassembly. - **Unique junctions** — if two junctions share homology, fragments can swap; redesign so each overlap is unique. ## Step 2 — Golden Gate Assembly ```bash tu run DNA_golden_gate_design '{"operation":"golden_gate_design", "parts":["ATGGCG...AAGAAC","CTGAGC...CTGATC","GAGGAG...GTGGTG"], "enzyme":"BsaI"}' ``` Returns `parts_with_overhangs`: each part's unique 4-bp `left_overhang`/`right_overhang` and the `full_sequence` flanked by the Type IIS recognition sites (e.g. BsaI `GGTCTC(N1)` … cutting outside its site to leave the 4-bp fusion overhang). **Golden Gate design rules** - **Domestication is mandatory.** The chosen enzyme's site (BsaI `GGTCTC`, BbsI `GAAGAC`) must NOT occur **inside** any part, or it will be cut internally. Remove internal sites by silent mutation before assembly — check every part. Don't rely on memorized recognition sites for a less common enzyme, or when a part's internal site can't be silently removed and you need an isoschizomer instead: `REBASE_get_enzyme` (site + methylation sensitivity) and `REBASE_list_isoschizomers` (alternative enzymes cutting the same site) are the authoritative lookup. - **Overhangs must be unique and non-palindromic.** Each 4-bp fusion site must differ from the others and not equal its own reverse complement, or junctions misligate. The tool assigns unique non-palindromic overhangs; keep them. - **Avoid high-GC or all-AT overhangs**; published high-fidelity overhang sets (e.g. Potapov 2018) ligate most cleanly. - **Order is encoded by the overhangs**, not by listing order — the 4-bp junctions define assembly. ## Step 3 — QC before ordering `scripts/cloning_qc.py` screens parts for the problems above: internal BsaI/BbsI sites (Golden Gate), overhang uniqueness/palindromes, and Gibson overlap GC/length — and flags PASS/WARN. ## Step 4 — Gotchas (state these) - **Internal Type IIS sites** (Golden Gate) — the #1 failure; domesticate every part. - **Non-unique Gibson overlaps** or shared homology → fragment swapping / misassembly. - **Repeats and strong secondary structure** at junctions reduce efficiency in both methods. - **Overlap Tm imbalance** (Gibson) → some junctions form, others don't. - **Generating the fragments** still needs primers with the overlaps/overhangs appended — design and QC those in `tooluniverse-primer-design` (and BLAST for specificity). ## Working backwards — what does an existing assembly produce? The reverse question ("I combined these plasmids in a Golden Gate reaction with Esp3I — what does the product express / what does the gRNA target?") is answered by one call. Do **not** hand-write a digestion/ligation simulator. ```bash tu run DNA_golden_gate_assemble '{"fragments":["<plasmid1>","<plasmid2>","<plasmid3>"], "enzyme":"Esp3I","labels":["pLAB-CTU","pLAB-gTU2E","pLAB-CH3"]}' ``` It digests each input, drops the fragments that keep a recognition site (those are re-cut in the reaction and cannot persist), chains the rest by matching 4-bp overhangs, and returns `product_sequence`, `product_length` and the `assembly_order` with the overhang at every junction. Inputs are treated as circular plasmids unless you pass `circular: false`. Then **annotate the product**. Locate features in `product_sequence` (promoter, ORF, gRNA spacer). For a gRNA cassette the spacer is the ~20 nt immediately 5′ of the scaffold (`GTTTTAGAGCTAGAAATAGCAAG`); identify its target by matching that spacer against the genome (`BLAST_*`, or an Ensembl/NCBI/SGD sequence lookup) and check for an adjacent PAM. Match the **species implied by the construct** — yeast tRNA/Pol III parts mean search the yeast genome, not human. If the assembly reports that the fragments do not chain, digest the inputs individually with `DNA_virtual_digest` (`circular: true`) to see what each released: a Golden Gate donor carries its two Type IIS sites **inverted** around the insert, so a correct digest gives **2 fragments** per plasmid. Getting 1 means the enzyme name or `circular` is wrong — not that the plasmid lacks sites. Enzyme names: `Esp3I` and `BsmBI` are the same enzyme (`CGTCTC`); `BsaI` (`GGTCTC`), `BbsI` (`GAAGAC`) and `SapI` (`GCTCTTC`) all resolve too. ## Honest limitations - Digestion and overhang-driven ligation are simulated faithfully (`DNA_virtual_digest` and `DNA_golden_gate_assemble` cut both strands at each enzyme's real offset, including Type IIS enzymes that cut outside their site). What is *not* modelled is reaction efficiency — overhang ligation bias, partial digestion, incorrect-but-possible junctions — so a returned product is the intended assembly, not a yield prediction. Validate by sequencing the assembled construct. - No vector-backbone or ORF-frame checking — confirm reading frame and backbone compatibility yourself. ## Related skills - `tooluniverse-primer-design` — design the PCR primers (with homology arms / Type IIS tails) to make the fragments. - `tooluniverse-sequence-analysis` — handle the input sequences.