| name | algo-suffix-arrays |
| description | Build a suffix array (Manber-Myers O(n log n)) and LCP array (Kasai's O(n)) in Python; binary-search substrings, count k-mers, find longest repeated motifs. Use for text indexing, pattern search, or aligner (BWA-like) internals. |
| tool_type | python |
| primary_tool | Python |
Suffix Arrays
When to Use
- Need to search a fixed text for many different patterns (build once, query O(m log n) each)
- Implementing or understanding the index behind short-read aligners (BWA, bowtie) or full-text search
- Finding the longest repeated substring/motif, counting distinct substrings, or de-duplicating k-mers in a DNA sequence
- Memory-constrained alternative to a suffix tree (an
int array vs. a pointer-heavy tree)
- Comparing construction strategies (naive vs. doubling) for a coursework/algorithms exercise
Version Compatibility
Pure Python 3.8+ (uses only collections, list slicing, str comparisons). No third-party dependencies. For production-scale genomic indexing (millions of bases), use pydivsufsort or pysuffixarray (SA-IS, O(n)) instead of the O(n log n) code here.
Prerequisites
- Comfortable with Python string slicing and binary search
- Related:
algo-suffix-trees (tree alternative), algo-kmp-algorithm / algo-rabin-karp (single-pattern search without an index)
- No external packages required
Always append a sentinel (e.g. '$') lexicographically smaller than every other character โ guarantees no suffix is a prefix of another, so sorting is well-defined.
Construction
Goal: Turn a string into SA, an array of integers where SA[i] is the start position of the i-th lexicographically smallest suffix.
Approach: Naive sort is easiest to reason about (O(n^2 log n) โ each of the O(n log n) comparisons costs O(n)). Manber-Myers replaces whole-suffix comparisons with O(1) rank-pair comparisons by doubling the compared prefix length each round, giving O(n log n).
def build_suffix_array_naive(text: str) -> list[int]:
"""Sort all suffixes directly. O(n^2 log n) time, O(n^2) space.
>>> build_suffix_array_naive("banana$")
[6, 5, 3, 1, 0, 4, 2]
"""
n = len(text)
suffixes = [(text[i:], i) for i in range(n)]
suffixes.sort(key=lambda pair: pair[0])
return [pos for _, pos in suffixes]
def build_suffix_array_manber_myers(text: str) -> list[int]:
"""Doubling-rank construction. O(n log n) time, O(n) space.
Each round sorts by (rank[i], rank[i+k]) pairs -- an O(1) comparison
key -- instead of comparing raw substrings, then re-derives ranks.
>>> build_suffix_array_manber_myers("banana$")
[6, 5, 3, 1, 0, 4, 2]
"""
n = len(text)
if n <= 1:
return list(range(n))
sa = list(range(n))
rank = [ord(c) for c in text]
tmp = [0] * n
k = 1
while k < n:
def key(i, k=k):
return (rank[i], rank[i + k] if i + k < n else -1)
sa.sort(key=key)
tmp[sa[0]] =
i (, n):
tmp[sa[i]] = tmp[sa[i - ]] + ( key(sa[i]) > key(sa[i - ]) )
rank, tmp = tmp, rank
rank[sa[-]] == n - :
k *=
sa
Pattern Search and LCP Array
Goal: Given SA, find every occurrence of a pattern, and find the longest repeated substring.
Approach: A pattern occurring in text must be a prefix of some suffix, and suffixes are sorted in SA, so binary search finds the contiguous range [lower, upper) of matching suffixes in O(m log n). Kasai's algorithm then builds the LCP array (LCP[i] = shared prefix length of suffixes SA[i-1] and SA[i]) in O(n) by reusing the previous match length across the pass, avoiding re-scanning from zero each time.
def search_pattern(text: str, sa: list[int], pattern: str) -> list[int]:
"""Binary search for all occurrences of pattern. O(m log n).
>>> sa = build_suffix_array_naive("banana$")
>>> search_pattern("banana$", sa, "ana")
[1, 3]
"""
n, m = len(text), len(pattern)
if m == 0:
return list(range(n))
def bound(strict):
lo, hi = 0, n
while lo < hi:
mid = (lo + hi) // 2
suffix_prefix = text[sa[mid]:sa[mid] + m]
cond = suffix_prefix <= pattern if strict else suffix_prefix < pattern
if cond:
lo = mid + 1
else:
hi = mid
return lo
lower, upper = bound(False), bound(True)
return sorted(sa[i] for i in range(lower, upper))
def build_lcp_array(text: str, sa: list[int]) -> list[int]:
"""Kasai's algorithm: LCP[i] = shared prefix length of SA[i-1], SA[i]. O(n).
>>> sa = build_suffix_array_naive("banana$")
>>> build_lcp_array("banana$", sa)
[0, 0, 1, 3, 0, 0, 2]
"""
n = (text)
rank = [] * n
i, pos (sa):
rank[pos] = i
lcp = [] * n
k =
i (n):
rank[i] == :
k =
j = sa[rank[i] - ]
i + k < n j + k < n text[i + k] == text[j + k]:
k +=
lcp[rank[i]] = k
k > :
k -=
lcp
() -> [, []]:
(text) <= :
(, [])
sa = build_suffix_array_manber_myers(text)
lcp = build_lcp_array(text, sa)
max_idx = (((lcp)), key= i: lcp[i])
lcp[max_idx] == :
(, [])
lrs = text[sa[max_idx]:sa[max_idx] + lcp[max_idx]]
(lrs, search_pattern(text, sa, lrs))
K-mer Counting on a DNA Sequence
Goal: Count occurrences of every distinct k-mer in a genomic string using the suffix array instead of a hash table.
Approach: Build SA, then for each starting index derive its k-mer and use search_pattern (or count contiguous SA runs with the same k-length prefix) to get its frequency; distinct k-mers are deduplicated via a set.
def count_kmer_occurrences(sequence: str, k: int) -> list[tuple[str, int]]:
"""Count every distinct k-mer using the suffix array + binary search.
Args:
sequence: DNA string, should end with a '$' sentinel.
k: k-mer length.
Returns:
(kmer, count) pairs sorted by descending count, then kmer.
"""
sa = build_suffix_array_naive(sequence)
seen = set()
counts = []
for pos in sa:
kmer = sequence[pos:pos + k]
if len(kmer) < k or kmer in seen or "$" in kmer:
continue
seen.add(kmer)
counts.append((kmer, len(search_pattern(sequence, sa, kmer))))
counts.sort(key=lambda pair: (-pair[1], pair[0]))
return counts
if __name__ == "__main__":
dna = "ATCGATCGATCGAATTCCGATCGATCGATCG$"
top5 = count_kmer_occurrences(dna, k=4)[:5]
assert top5[0][0] == "ATCG" and top5[0][1] >= 4, top5
assert longest_repeated_substring("banana$") == ("ana", [1, 3])
print("top 4-mers:", top5)
Complexity Comparison
| Method | Construction | Space | Pattern search |
|---|
| Naive | O(n^2 log n) | O(n^2) | O(m log n) |
| Manber-Myers | O(n log n) | O(n) | O(m log n) |
| SA-IS / DC3 | O(n) | O(n) | O(m log n) |
| LCP (Kasai) | O(n), needs SA first | O(n) | n/a |
Pitfalls
- Forgetting the sentinel
'$' causes incorrect sorting when one suffix is a true prefix of another (e.g. "ab" vs "abab").
- Naive construction materializes every suffix as a Python string slice โ O(n^2) memory; switch to Manber-Myers (or SA-IS) once
n exceeds a few thousand.
search_pattern's two binary searches must use < for the lower bound and <= for the upper bound (or the run range is off by one/empty).
- Kasai's algorithm requires
sa and its rank (inverse permutation) both built from the same text โ rebuild both if the text changes.
- For real genomes, use a C-backed SA-IS library (
pydivsufsort) โ the pure-Python code here is for correctness/teaching, not multi-megabase genomes.
See Also
algo-suffix-trees โ pointer-based alternative structure with the same query capabilities
algo-kmp-algorithm, algo-rabin-karp โ single-pattern search without building a full index
algo-aho-corasick โ multi-pattern search when patterns (not the text) are fixed in advance
bio-read-alignment-bwa-alignment โ real-world aligner built on an FM-index/suffix-array-like structure