| name | bio-applied-ribo-seq |
| description | Ribo-seq: cutadapt/bowtie2 adapter+rRNA removal, plastid P-site calibration, 3-nt periodicity QC, RiboCode/ribotricer ORF calling, translation efficiency. Use when user has ribosome profiling or footprint data. |
| tool_type | python |
| primary_tool | Python |
Ribosome Profiling (Ribo-seq) Analysis
When to Use
- Processing raw ribosome-profiling FASTQ files: 3' adapter trimming and rRNA/tRNA contaminant depletion before genome/transcriptome alignment
- Calibrating P-site offsets per read length from a Ribo-seq BAM and checking 3-nt (triplet) reading-frame periodicity as a QC gate
- Detecting actively translated ORFs (annotated CDS, uORFs, novel/non-canonical ORFs) with RiboCode, ribotricer, or plastid
- Computing translation efficiency (TE = Ribo-seq footprint density / matched RNA-seq mRNA abundance) per gene or transcript
- Deciding whether a Ribo-seq library passed QC (periodicity, footprint length distribution, frame distribution) before downstream ORF/TE analysis
Version Compatibility
- cutadapt >= 4.4, bowtie2 >= 2.5.x (rRNA/tRNA depletion index), STAR >= 2.7.11a (splice-aware genome alignment)
- plastid >= 0.6.1 (Python 3.9-3.11; metagene/P-site tooling,
psite/metagene CLI and library)
- RiboCode >= 1.2.31 (annotation-based ORF calling with permutation-test periodicity)
- ribotricer >= 1.3.3 (reference-free-ish periodicity-score ORF detection,
prepare-orfs + detect-orfs)
- pysam >= 0.22, numpy >= 1.26, pandas >= 2.0, scipy >= 1.11, statsmodels >= 0.14
Prerequisites
pip install pysam pandas numpy scipy statsmodels plastid
pip install RiboCode ribotricer; cutadapt, bowtie2/STAR on PATH
- A genome FASTA + GTF, an rRNA/tRNA-only bowtie2 index, and (for TE) a matched RNA-seq count matrix from the same samples
- Familiarity with
bio-applied-rna-seq-analysis (general RNA-seq counting/DE) and bio-applied-ngs-fundamentals (FASTQ/BAM basics)
Adapter Trimming and rRNA/tRNA Depletion
Goal: turn a raw Ribo-seq FASTQ (17-34 nt footprints, usually 3'-adapter-ligated) into a clean, rRNA-free FASTQ ready for splice-aware alignment.
Approach: trim the 3' adapter with size selection matching monosome footprint length, then align to a combined rRNA+tRNA bowtie2 index and keep only the unaligned reads (--un-gz) โ rRNA/tRNA make up 50-90% of raw Ribo-seq reads and must be removed before genome alignment or they dominate coverage and periodicity signal.
import subprocess
import re
def remove_adapters_and_rrna(fastq_in: str, rrna_index: str, adapter: str = "AGATCGGAAGAGCACACGTCT",
min_len: int = 20, max_len: int = 38, threads: int = 8) -> dict:
"""Trim 3' adapter and deplete rRNA/tRNA reads from a raw Ribo-seq FASTQ.
fastq_in: raw single-end Ribo-seq FASTQ(.gz).
rrna_index: bowtie2 index built from species rRNA+tRNA sequences (e.g. from
UCSC/RefSeq rRNA repeat annotations plus a tRNA database).
adapter: 3' adapter (default is the standard Illumina/TruSeq small-RNA adapter
used by most Ribo-seq kits).
min_len/max_len: post-trim size window; 20-38 nt keeps monosome footprints
(~28-32 nt) while allowing disome/short-footprint variation.
Returns a dict of read counts through each step (n_input, n_trimmed, n_rrna,
n_retained) parsed from cutadapt/bowtie2 stderr.
"""
trimmed_fq = fastq_in.replace(".fastq", ".trimmed.fastq")
cutadapt_cmd = ["cutadapt", "-a", adapter, "-m", str(min_len), "-M", str(max_len),
"--discard-untrimmed", "-j", str(threads), "-o", trimmed_fq, fastq_in]
cutadapt_res = subprocess.run(cutadapt_cmd, check=True, capture_output=True, text=True)
n_input = int(re.search(r"Total reads processed:\s*([\d,]+)", cutadapt_res.stdout).group(1).replace(",", ""))
n_trimmed = int(re.search(, cutadapt_res.stdout).group().replace(, ))
clean_fq = fastq_in.replace(, )
bowtie2_cmd = [, , rrna_index, , trimmed_fq, , (threads),
, clean_fq, , ]
bowtie2_res = subprocess.run(bowtie2_cmd, check=, capture_output=, text=)
aligned_pct = (re.search(, bowtie2_res.stderr).group())
n_rrna = (n_trimmed * aligned_pct / )
{: n_input, : n_trimmed, : n_rrna,
: n_trimmed - n_rrna, : clean_fq}
P-site Offset Calibration and 3-nt Periodicity
Goal: convert raw footprint 5' alignment positions into P-site (decoding-center) positions, then confirm the library shows the expected triplet periodicity around start codons.
Approach: for reads mapped to a transcriptome/genome BAM near annotated start codons, find the modal distance from each read's 5' end to the start codon, stratified by read length (footprint offset is length-dependent, typically 12-15 nt in eukaryotes); apply that offset to every read of the same length to get P-site positions, then check what fraction fall in frame 0 vs 1/2 โ a healthy library shows >60-70% of P-sites in frame 0.
import pysam
from collections import defaultdict, Counter
def calibrate_psite_offsets(bam_path: str, start_codon_pos: dict, read_length_range: tuple = (25, 35)) -> dict:
"""Calibrate per-read-length P-site offsets from 5' footprint ends near start codons.
bam_path: transcriptome-coordinate BAM (splice-aware genome BAMs need CDS
coordinates converted to transcript space first, e.g. with plastid).
start_codon_pos: dict transcript_id -> 0-based transcript-coordinate position
of the start codon's first base (from a GTF/plastid Transcript object).
read_length_range: footprint lengths to calibrate over (monosome range).
Returns {read_length: offset_nt}, the modal 5'-end-to-start-codon distance
per length โ the offset to add to a read's 5' position to get its P-site.
"""
bam = pysam.AlignmentFile(bam_path, "rb")
offset_counts = defaultdict(Counter)
for tx_id, start_pos in start_codon_pos.items():
if tx_id not in bam.references:
continue
for read in bam.fetch(tx_id):
if read.is_unmapped or read.is_reverse:
continue
rl = read.query_length
if not (read_length_range[0] <= rl <= read_length_range[1]):
continue
offset = start_pos - read.reference_start
if 0 <= offset < 20:
offset_counts[rl][offset] += 1
return {rl: counts.most_common()[][] rl, counts offset_counts.items() counts}
() -> :
bam = pysam.AlignmentFile(bam_path, )
frame_counts = Counter()
tx_id, start_pos start_codon_pos.items():
tx_id bam.references:
read bam.fetch(tx_id):
read.is_unmapped read.is_reverse:
offset = psite_offsets.get(read.query_length)
offset :
psite = read.reference_start + offset
frame_counts[(psite - start_pos) % ] +=
total = (frame_counts.values())
{: ( * frame_counts.get(f, ) / total, ) f (, , )}
ORF Detection and Translation Efficiency
Goal: identify actively translated ORFs and quantify translation efficiency (TE) relative to mRNA abundance.
Approach: for ORF calling, use a dedicated periodicity-aware tool rather than hand-rolled logic โ RiboCode tests annotated-plus-novel ORFs (uORFs, dORFs, ncRNA ORFs) with a permutation test on triplet periodicity (RiboCode_prepare_transcripts then RiboCode -c config.txt -l no -g); ribotricer scores arbitrary ORF candidates (ribotricer prepare-orfs + ribotricer detect-orfs) using a multitaper/periodicity metric, tool-agnostic to species annotation quality; plastid provides the underlying P-site/metagene machinery (plastid.plotting, psite, metagene) both tools build on, and is the right choice when you need custom metagene profiles rather than a full ORF caller. Once footprint counts per gene are in hand, TE is simply the library-size-normalized Ribo-seq/RNA-seq ratio:
import numpy as np
import pandas as pd
from scipy import stats
def translation_efficiency(ribo_counts: pd.DataFrame, rna_counts: pd.DataFrame, pseudocount: float = 1.0) -> pd.DataFrame:
"""Compute per-gene log2 translation efficiency (Ribo-seq / RNA-seq) across matched samples.
ribo_counts, rna_counts: genes x samples raw count DataFrames with identical
column order (same samples, footprint counts vs. mRNA read counts).
pseudocount: added before logging to avoid log(0) for low-count genes.
Returns a DataFrame with per-sample log2(TE), the across-sample mean log2(TE),
and a one-sample t-test p-value against log2(TE)=0 (tests whether a gene is
translationally up/down-regulated beyond what mRNA level predicts).
"""
ribo_cpm = ribo_counts / ribo_counts.sum(axis=0) * 1e6
rna_cpm = rna_counts / rna_counts.sum(axis=0) * 1e6
log2_te = np.log2(ribo_cpm + pseudocount) - np.log2(rna_cpm + pseudocount)
result = log2_te.copy()
result["mean_log2_TE"] = log2_te.mean(axis=1)
result["pvalue"] = [stats.ttest_1samp(row.values, popmean=0.0).pvalue for _, row in log2_te.iterrows()]
return result.sort_values("pvalue")
Pitfalls
- Genomic vs. transcript coordinates: P-site offset calibration and frame periodicity must be computed in transcript (spliced) coordinates โ a genomic BAM with introns will corrupt the modulo-3 frame calculation across splice junctions
- Skipping rRNA/tRNA depletion: raw Ribo-seq libraries are often 50-90% rRNA/tRNA; aligning without depletion wastes compute and can leave contaminant reads polluting coverage-based ORF calls
- One offset for all read lengths: the 5'-end-to-P-site distance depends on footprint length (nuclease digestion varies); applying a single fixed offset instead of a per-length table destroys periodicity
- TE from unmatched libraries: translation efficiency requires Ribo-seq and RNA-seq from the same samples/conditions with independent library-size normalization (CPM/TMM each); comparing to a public RNA-seq reference confounds TE with batch/condition effects
- Trusting low-count genes: log2(TE) is very noisy below ~1-2 reads/kb in either assay; filter genes on a minimum RNA-seq and Ribo-seq count/CPM threshold before ranking or testing TE changes
See Also
bio-applied-rna-seq-analysis โ general RNA-seq quantification/DE, needed for the matched mRNA side of TE
bio-applied-ngs-fundamentals โ FASTQ/BAM/GTF basics underlying alignment and coordinate handling here
bio-applied-advanced-ngs โ splice-aware alignment (STAR) and coverage-track workflows used upstream of P-site calibration
bio-applied-mirna-seq-pipeline โ parallel short-read adapter-trimming/size-selection workflow for another small-RNA-length library type