Discovers novel miRNAs and quantifies known miRNAs with miRDeep2 by scoring genome-mapped read stacks against the Dicer/Drosha biogenesis signature. Use when deciding whether a study needs de novo discovery at all versus known-miRNA quantification; choosing the species and related-species miRBase references; reading the miRDeep2 score as a signal-to-noise hypothesis rather than a fixed cutoff; or filtering novel candidates against tRNA/rRNA loci to reject the classic false positives.
Standardmäßig ist der Prompt ausgewählt, der zuerst die Quelle prüft. Sie können zu einem direkten Befehl wechseln oder eine lokale Kopie herunterladen.
Quelldateien prüfen
Lesen Sie SKILL.md und alle von SkillsMP angezeigten Begleitdateien, bevor Sie sich für eine Installation entscheiden.
Mit Codex oder Claude installieren Kopieren Sie diesen Prompt, fügen Sie ihn in Codex, Claude oder einen anderen Assistant ein und lassen Sie die Skill-Seite prüfen und installieren.
Ein direkter Befehl überspringt den Prüf-Prompt. Prüfen Sie die Quelle, bevor Sie ihn ausführen.
Discovers novel miRNAs and quantifies known miRNAs with miRDeep2 by scoring genome-mapped read stacks against the Dicer/Drosha biogenesis signature. Use when deciding whether a study needs de novo discovery at all versus known-miRNA quantification; choosing the species and related-species miRBase references; reading the miRDeep2 score as a signal-to-noise hypothesis rather than a fixed cutoff; or filtering novel candidates against tRNA/rRNA loci to reject the classic false positives.
Before using code patterns, verify installed versions match. If versions differ:
CLI: <tool> --version then <tool> --help to confirm flags
Python: pip show <package> then help(module.function) to check signatures
If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.
miRDeep2 Analysis
"Discover novel miRNAs from my small RNA-seq data" -> Map collapsed reads to the genome, excise candidate hairpins, fold them, and score how well the observed read stacks match the Dicer/Drosha processing signature.
The governing principle: a miRDeep2 score is a biogenesis hypothesis, not a validated miRNA
miRDeep2 does not detect miRNAs by sequence; it asks whether the reads piled on a genomic hairpin look like the product of Dicer/Drosha processing: a sharp, abundant MATURE arm, a lower-abundance STAR (passenger) arm with the correct ~2-nt 3' overhang geometry, a depleted loop, and a thermodynamically stable fold whose minimum free energy is lower than shuffled controls (the randfold p-value). A log-odds model converts that fit into a score (Friedländer 2012). The decisive consequence is that any locus producing a stacked, hairpin-foldable read pile can mimic the signature, so novel discovery is intrinsically high false-positive. The textbook failure is contaminating tRNA and rRNA fragments: tRNAs fold into stable cloverleaf arms and throw sharp, abundant read stacks that score as "novel miRNAs." A high score is a structural and expression hypothesis that demands orthogonal validation, never a finding.
There is no universal score cutoff. survey.pl sweeps cutoffs and reports, at each, the estimated true positives, false positives, signal-to-noise ratio, and an estimated FDR derived from permuted controls; Friedländer 2012 chose, per analysis, the lowest cutoff giving signal-to-noise >= 5. Asserting "score > 10 = high confidence" as a fixed rule is folklore: read the survey output, pick a cutoff for an acceptable estimated FDR, and report it.
Decision: is miRDeep2 the right tool?
Goal
Use
Why
Discover NOVEL miRNAs in an animal genome
miRDeep2 (full discovery)
The dedicated probabilistic biogenesis model; genome-anchored
Quantify KNOWN miRNAs + isomiRs + tRFs on a supported species
mirge3-analysis
Faster, isomiR-aware; discovery machinery is expensive and high-FP
Quantify KNOWN miRNAs only, no discovery
quantifier.pl (miRDeep2) or mirge3
Skip the discovery engine when discovery is not needed
Profile tRFs / piRNAs (not miRNAs)
trf-pirna-profiling
tRF/rRF stacks are miRDeep2 false positives, not the target
Plant small RNAs
ShortStack (see trf-pirna-profiling)
Plant hairpins and 24-nt siRNA biology break the animal model
Animal with NO genome assembly (non-model, single-cell)
Mirnovo (genome-free ML)
miRDeep2 is genome-anchored and cannot run without an assembly
miRDeep2 requires a reference GENOME and bowtie 1 (not bowtie2). The species and related-species miRBase references are load-bearing: the same-species mature/hairpin define "known," and the other-species mature provides conservation evidence that raises confidence in novel calls.
Workflow overview
collapsed reads (FASTA, _xN counts)
|
v mapper.pl --> bowtie align to genome, emit ARF
v
miRDeep2.pl --> excise hairpins, fold (RNAfold), randfold, score read stacks
|
v quantifier.pl --> known-miRNA counts (run alone if no discovery needed)
Step 1: Build the genome index (bowtie 1)
# miRDeep2 uses bowtie 1, NOT bowtie2
bowtie-build genome.fa genome_index
Step 2: Map reads with mapper.pl
mapper.pl reads.fastq \
-e -h -i -j \
-k TGGAATTCTCGGGTGCCAAGG \
-l 18 -m \
-p genome_index \
-s reads_collapsed.fa \
-t reads_vs_genome.arf \
-v
# -e: input is FASTQ -h: parse to FASTA -i: convert RNA to DNA# -j: remove reads with non-ACGTN -k: clip 3' adapter -l 18: discard < 18 nt# -m: collapse identical reads -p: bowtie index -s/-t: collapsed FASTA + ARF
Step 3: Prepare miRBase references
# miRBase distributes RNA (U) sequences; miRDeep2 needs DNA and no whitespace.# Pin the miRBase version - accessions and sequences change between releases.
wget https://www.mirbase.org/download/mature.fa
wget https://www.mirbase.org/download/hairpin.fa
# Same-species mature + hairpin (here human, hsa) and a related species for conservation
grep -A1 '>hsa-' mature.fa | grep -v '^--$' > mature_hsa.fa
grep -A1 '>hsa-' hairpin.fa | grep -v '^--$' > hairpin_hsa.fa
grep -A1 '>mmu-' mature.fa | grep -v '^--$' > mature_mmu.fa
# Convert U->T and strip spaces if the tool's extract_miRNAs.pl is not used:# sed '/^>/!s/U/T/g; /^>/!s/u/t/g' in.fa
Interactive report with read-stack and structure plots
miRNAs_expressed_all_samples_*.csv
Known-miRNA expression matrix
mirdeep_runs/, expression_analyses/, pdfs_*/
Intermediate read-stack alignments (.mrd) and structures
Reading and filtering results
import pandas as pd
defparse_mirdeep2_results(csv_path, score_cutoff):
# score_cutoff is NOT universal: choose it from survey.pl signal-to-noise / FDR,# then report the value. There is no fixed 'score > 10' rule.
df = pd.read_csv(csv_path, sep='\t', skiprows=1)
return df[df['miRDeep2 score'] >= score_cutoff]
defreject_structured_rna_false_positives(candidates, trna_rrna_bed):
# The classic miRDeep2 false positive is a tRNA/rRNA fragment hairpin.# Require: (a) no overlap with tRNA/rRNA/snoRNA loci, (b) some star-arm read# support, (c) reproducibility across replicates, before trusting a novel call.return candidates # intersect coordinates against trna_rrna_bed with bedtools upstream
Calling a novel miRNA real: the community criteria
A miRDeep2 score is a prefilter, not a verdict. A genuine novel miRNA must satisfy the community annotation criteria (Ambros 2003; MirGeneDB), and the deliverable should be a per-candidate criteria table, not a score-ranked list:
CONSISTENT 5' processing of BOTH the mature and star arms across reads - this 5'-end homogeneity is the single most discriminating signal (a precise 5' end is what defines the seed; degradation gives smeared ends).
A mature/star duplex with the ~2-nt 3' overhang geometry of Dicer cleavage.
Star-arm read support (real miRNAs usually show some passenger reads).
A ~22-nt mature length and a hairpin without large internal loops/bulges.
Conservation or Dicer/Drosha-dependence (loss of signal on knockdown), and reproducibility across replicates.
Common Errors
Symptom
Cause
Fix
"novel miRNAs" cluster at tRNA/rRNA loci
Structured-RNA fragments fold into scoring hairpins
Intersect candidates against GtRNAdb/rRNA annotations and discard overlaps
mapper.pl fails or maps almost nothing
bowtie2 index supplied, or genome not indexed with bowtie 1
Rebuild with bowtie-build (bowtie 1); confirm reads were adapter-trimmed
miRDeep2.pl errors on the reference FASTA
miRBase U-containing or whitespace-laden sequences
Convert U->T and strip header whitespace, or use the bundled extraction script
Treating score > 10 as truth
No universal cutoff exists
Use survey.pl signal-to-noise/FDR to set and report a cutoff
Very few known miRNAs detected
Wrong species -t, or reads not collapsed (_xN)
Set the correct species code; collapse reads in mapper.pl (-m)
smrna-preprocessing - Adapter trimming and read collapsing before mapping
mirge3-analysis - Faster known-miRNA + isomiR quantification when discovery is not needed
differential-mirna - Differential expression of the resulting count matrix
trf-pirna-profiling - For tRF/piRNA biology, which would otherwise appear as miRDeep2 false positives
genome-annotation/ncrna-annotation - Annotating tRNA/rRNA/snoRNA loci to filter false positives
References
Friedländer MR, Mackowiak SD, Li N, Chen W, Rajewsky N. 2012. miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades. Nucleic Acids Res 40:37-52. doi:10.1093/nar/gkr688
Friedländer MR, Chen W, Adamidi C, et al. 2008. Discovering microRNAs from deep sequencing data using miRDeep. Nat Biotechnol 26:407-415. doi:10.1038/nbt1394
Bonnet E, Wuyts J, Rouzé P, Van de Peer Y. 2004. Evidence that microRNA precursors, unlike other non-coding RNAs, have lower folding free energies than random sequences. Bioinformatics 20:2911-2917. doi:10.1093/bioinformatics/bth374
Kozomara A, Birgaoanu M, Griffiths-Jones S. 2019. miRBase: from microRNA sequences to function. Nucleic Acids Res 47:D155-D162. doi:10.1093/nar/gky1141
Fromm B, Domanska D, Høye E, et al. 2020. MirGeneDB 2.0: the metazoan microRNA complement. Nucleic Acids Res 48:D1172-D1180. doi:10.1093/nar/gkz885
Ambros V, Bartel B, Bartel DP, et al. 2003. A uniform system for microRNA annotation. RNA 9:277-279. doi:10.1261/rna.2183803
