plannotate-plasmid-annotation

name	plannotate-plasmid-annotation
description	Auto-annotate plasmids with features (promoters, terminators, resistance, origins, tags, fluorescent proteins) via BLAST against curated DBs (Addgene, fpbase, SnapGene). FASTA or raw sequence in; annotated GenBank, interactive HTML maps, CSV tables out. Handles circular topology. Use to verify synthetic constructs, prep Addgene submissions, share maps, or batch-annotate cloning libraries.
license	GPL-3.0

pLannotate Plasmid Annotation

Overview

pLannotate annotates plasmid sequences by running BLAST searches against a curated library of over 5,000 features sourced from Addgene, NCBI, and fpbase. It identifies promoters, terminators, antibiotic resistance genes, origins of replication, tags, and fluorescent proteins while correctly handling circular plasmid topology — avoiding split-feature artifacts that arise from naive linear alignment. Results are written as annotated GenBank files for downstream use in SnapGene, Benchling, or BioPython, as interactive HTML plasmid maps for sharing and review, and as CSV tables for programmatic filtering. Both a Python API and a command-line interface are provided; a Streamlit web app is also bundled for exploratory use.

When to Use

• Annotating a plasmid sequence received from a collaborator or downloaded from Addgene with no accompanying map
• Verifying that all expected elements (promoter, insert, resistance marker, origin) are present after assembly or mutagenesis
• Preparing a GenBank submission or Addgene deposit that requires a complete feature table
• Batch-annotating a library of synthetic constructs produced by combinatorial cloning
• Generating a shareable interactive plasmid map (HTML) without requiring SnapGene or Benchling licenses
• Checking a de-novo synthesized gene block for unintended regulatory elements or cryptic ORFs before cloning
• Use SnapGene or Benchling instead when you need a full-featured GUI plasmid editor with primer design and cloning simulation workflows; pLannotate is best for automated, scriptable annotation
• Use Prokka instead when annotating a complete bacterial genome or a large linear chromosomal sequence; pLannotate is optimized for plasmid-sized sequences up to ~50 kb

Prerequisites

• Python packages: plannotate, biopython (optional, for GenBank parsing)
• System dependency: BLAST+ must be available on PATH (installed automatically via conda; manual install needed for pip)
• Input: Plasmid sequence in FASTA format or as a plain Python string
• Data requirements: Sequences typically 1–20 kb; very large plasmids (>50 kb) may be slow

# Install via pip (requires BLAST+ on PATH)
pip install plannotate

# Install via conda (recommended — handles BLAST+ automatically)
conda install -c conda-forge -c bioconda plannotate

# Verify installation
plannotate --help
python -c "import plannotate; print('plannotate OK')"

Quick Start

from plannotate import annotate, write_genbank, create_bokeh_chart
from Bio import SeqIO

# Load plasmid from FASTA
record = next(SeqIO.parse("plasmid.fasta", "fasta"))
sequence = str(record.seq)

# Annotate (circular, against Addgene database)
results = annotate(sequence, linear=False, db="addgene")
print(f"Found {len(results)} features")
print(results[["Feature", "Feature_type", "pct_identity", "pct_query_cov"]].to_string())

# Export GenBank file
write_genbank(sequence, results, output_file="plasmid_annotated.gb")

# Generate interactive HTML map
create_bokeh_chart(sequence, results, output_file="plasmid_map.html")
print("Outputs: plasmid_annotated.gb, plasmid_map.html")

Workflow

Step 1: Load Plasmid Sequence

Load the plasmid sequence from a FASTA file, a GenBank file (stripping existing annotations for re-annotation), or a raw sequence string. Validate length and base composition before annotation.

from Bio import SeqIO
import os

# Option A: Load from FASTA
def load_fasta(path):
    record = next(SeqIO.parse(path, "fasta"))
    seq = str(record.seq).upper()
    return seq, record.id

# Option B: Load from GenBank (strip annotations, keep sequence)
def load_genbank(path):
    record = next(SeqIO.parse(path, "genbank"))
    seq = str(record.seq).upper()
    return seq, record.id

# Option C: Raw sequence string
raw_seq = "ATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTT"

# Validate sequence
def validate_plasmid(seq, name="plasmid"):
    valid_bases = set("ATGCNRYSWKMBDHV")
    invalid = set(seq.upper()) - valid_bases
    if invalid:
        raise ValueError(f"Invalid bases in {name}: {invalid}")
    if len(seq) < 100:
        raise ValueError(f"Sequence too short ({len(seq)} bp); minimum 100 bp")
    gc = (seq.count("G") + seq.count("C")) / len(seq) * 100
    ()
     seq

seq, plasmid_id = load_fasta()
validate_plasmid(seq, plasmid_id)

Step 2: Run BLAST-Based Annotation

Run annotation using the selected database. The linear flag controls whether the sequence is treated as circular (default for plasmids) or linear (for gene blocks and linear fragments).

from plannotate import annotate

# Annotate circular plasmid against the Addgene database (most comprehensive for common vectors)
results = annotate(
    seq,
    linear=False,       # False = circular plasmid (default)
    db="addgene",       # Database: "addgene", "fpbase", or "snapgene"
)

print(f"Total features detected: {len(results)}")
print(f"\nColumns: {list(results.columns)}")

# Preview feature table
cols = ["Feature", "Feature_type", "start", "end", "strand", "pct_identity", "pct_query_cov"]
print(results[cols].sort_values("start").to_string(index=False))

Step 3: Filter Features by Quality Thresholds

Review annotation confidence using BLAST identity and query coverage scores. High-confidence annotations have >95% identity and >90% coverage; partial hits may indicate truncated or mutated features.

import pandas as pd

# Inspect hit quality distribution
print("Identity percentile summary:")
print(results["pct_identity"].describe().round(1))
print("\nCoverage percentile summary:")
print(results["pct_query_cov"].describe().round(1))

# Separate high- and low-confidence hits
high_conf = results[
    (results["pct_identity"] >= 95) &
    (results["pct_query_cov"] >= 90)
].copy()

low_conf = results[
    (results["pct_identity"] < 95) |
    (results["pct_query_cov"] < 90)
].copy()

print(f"\nHigh-confidence features (identity>=95%, coverage>=90%): {len(high_conf)}")
print(f"Low-confidence / partial features:                       {len(low_conf)}")

if not low_conf.empty:
    print("\nLow-confidence features (review manually):")
    print(low_conf[["Feature", "Feature_type", "pct_identity", "pct_query_cov"]].to_string(index=False))

# Save filtered table
results.to_csv("all_features.csv", index=False)
high_conf.to_csv("high_confidence_features.csv", index=)
()

Step 4: Export Annotated GenBank File

Write the annotated sequence to GenBank format for import into plasmid editors (SnapGene, Benchling, Geneious, ApE) and for BioPython-based downstream analysis.

from plannotate import write_genbank

# Write full annotation (all features)
write_genbank(seq, results, output_file="plasmid_annotated.gb")
print("Written: plasmid_annotated.gb")

# Write with high-confidence features only
write_genbank(seq, high_conf, output_file="plasmid_highconf.gb")
print("Written: plasmid_highconf.gb")

# Verify using BioPython
from Bio import SeqIO
record = next(SeqIO.parse("plasmid_annotated.gb", "genbank"))
print(f"\nGenBank verification:")
print(f"  Sequence length: {len(record.seq):,} bp")
print(f"  Features: {len(record.features)}")
for feat in record.features:
    label = feat.qualifiers.get("label", ["(unlabeled)"])[0]
    print(f"  [{feat.type:20s}] {label} @ {feat.location}")

Step 5: Generate Interactive HTML Visualization

Create a Bokeh-based interactive plasmid map. The HTML file is self-contained and can be shared without any server infrastructure.

from plannotate import create_bokeh_chart

# Generate interactive circular plasmid map
create_bokeh_chart(
    seq,
    results,
    output_file="plasmid_map.html",
)
print("Interactive map saved: plasmid_map.html")
print("Open in any browser — no server required")

# Tip: open automatically in the default browser
import webbrowser, os
webbrowser.open(f"file://{os.path.abspath('plasmid_map.html')}")

Step 6: Parse GenBank Output with BioPython

Extract annotated features programmatically for downstream analysis — restriction site mapping, primer design, or construct verification reports.

from Bio import SeqIO
from Bio.SeqFeature import FeatureLocation
import pandas as pd

record = next(SeqIO.parse("plasmid_annotated.gb", "genbank"))

# Build a feature DataFrame from the GenBank record
rows = []
for feat in record.features:
    label = feat.qualifiers.get("label", [""])[0]
    note  = feat.qualifiers.get("note",  [""])[0]
    rows.append({
        "type":   feat.type,
        "label":  label,
        "note":   note,
        "start":  int(feat.location.start),
        "end":    int(feat.location.end),
        "strand": feat.location.strand,
        "length": len(feat.location),
    })

feat_df = pd.DataFrame(rows)
print(feat_df.to_string(index=False))

# Example: find antibiotic resistance genes
resistance = feat_df[feat_df["label"].str.contains(
    r"AmpR|KanR|CmR|TetR|SpecR|HygR|ZeoR|BlastR|GentR",
    case=False, na=False, regex=True
)]
print(f"\nAntibiotic resistance markers found: {len(resistance)}")
print(resistance[["label", "start", , ]].to_string(index=))

Step 7: Batch Annotate Multiple Plasmids

Annotate an entire cloning library from a multi-FASTA file or a directory of individual FASTA files and aggregate results into a single summary table.

from plannotate import annotate, write_genbank, create_bokeh_chart
from Bio import SeqIO
import pandas as pd
import os

input_dir  = "plasmids/"          # directory of *.fasta files
output_dir = "annotated_results/"
os.makedirs(output_dir, exist_ok=True)

summary_rows = []

for fasta_file in sorted(f for f in os.listdir(input_dir) if f.endswith(".fasta")):
    plasmid_name = fasta_file.replace(".fasta", "")
    fasta_path   = os.path.join(input_dir, fasta_file)

    record = next(SeqIO.parse(fasta_path, "fasta"))
    seq    = str(record.seq).upper()

    print(f"Annotating {plasmid_name} ({len(seq):,} bp)...", end=" ")
    results = annotate(seq, linear=False, db="addgene")
    print(f"{len(results)} features")

    # Save per-plasmid outputs
    write_genbank(
        seq, results,
        output_file=os.path.join(output_dir, f"{plasmid_name}.gb")
    )
    create_bokeh_chart(
        seq, results,
        output_file=os.path.join(output_dir, f"{plasmid_name}.html")
    )
    results.to_csv(os.path.join(output_dir, f"{plasmid_name}_features.csv"), index=False)

    # Accumulate for summary
    results[] = plasmid_name
    summary_rows.append(results)


summary = pd.concat(summary_rows, ignore_index=)
summary.to_csv(os.path.join(output_dir, ), index=)
()
()

Key Parameters

Parameter	Default	Range / Options	Effect
linear	False	True, False	Treat sequence as linear (True) or circular (False); circular mode handles split features at the origin correctly
db	"addgene"	"addgene", "fpbase", "snapgene"	Feature database to search; addgene is broadest (promoters, resistance genes, origins, tags); fpbase adds fluorescent protein variants; snapgene includes SnapGene-curated features
min_len	0	0–500 bp	Minimum feature length in bp; increase to suppress short spurious matches
blast_identity_threshold	95	70–100 %	Minimum BLAST % identity to report a hit; lower values detect diverged homologs but increase false positives
--html (CLI)	off	flag	Generate interactive HTML plasmid map alongside GenBank output
--csv (CLI)	off	flag	Write CSV feature table to the output directory
--linear (CLI)	off	flag	Treat input as linear sequence (default is circular)
--file / --input (CLI)	required	FASTA path	Input plasmid sequence in FASTA format

Common Recipes

Recipe: Launch Web App for Interactive Use

When to use: exploring a single plasmid interactively without writing code, or sharing with wet-lab collaborators who prefer a browser interface.

# Launch the pLannotate Streamlit web app (opens in browser at localhost:5000)
plannotate streamlit

# Or specify a custom port
plannotate streamlit --port 8501

Recipe: CLI Batch Annotation

When to use: annotating multiple plasmids in a scripted workflow or on a remote server without Python scripting.

# Single plasmid
plannotate batch \
    --input plasmid.fasta \
    --output results/ \
    --html \
    --csv

# Multiple plasmids via shell glob
for f in plasmids/*.fasta; do
    name=$(basename "$f" .fasta)
    plannotate batch \
        --input "$f" \
        --output "annotated/${name}/" \
        --html --csv
done
echo "Done. Outputs in annotated/"

Recipe: Compare Annotations Before and After Mutagenesis

When to use: verifying that a site-directed mutagenesis or insertion did not disrupt existing features or introduce unintended ones.

from plannotate import annotate
from Bio import SeqIO
import pandas as pd

def annotation_diff(seq_before, seq_after, db="addgene"):
    res_before = annotate(seq_before, linear=False, db=db)
    res_after  = annotate(seq_after,  linear=False, db=db)

    features_before = set(res_before["Feature"])
    features_after  = set(res_after["Feature"])

    gained = features_after  - features_before
    lost   = features_before - features_after
    shared = features_before & features_after

    print(f"Shared features: {len(shared)}")
    print(f"Gained features: {gained if gained else 'none'}")
    print(f"Lost features:   {lost   if lost   else 'none'}")
    return res_before, res_after

seq_wt  = str(next(SeqIO.parse("plasmid_wt.fasta",  "fasta")).seq)
seq_mut = str(next(SeqIO.parse("plasmid_mut.fasta", "fasta")).seq)
res_before, res_after = annotation_diff(seq_wt, seq_mut)

Recipe: Export Feature Table to Excel with Conditional Formatting

When to use: sharing annotation results with collaborators who prefer spreadsheets over GenBank files.

from plannotate import annotate
from Bio import SeqIO
import pandas as pd

seq = str(next(SeqIO.parse("plasmid.fasta", "fasta")).seq)
results = annotate(seq, linear=False, db="addgene")

# Tidy column selection and renaming
export = results[[
    "Feature", "Feature_type", "start", "end", "strand",
    "pct_identity", "pct_query_cov", "database"
]].copy()
export.columns = [
    "Feature Name", "Type", "Start (bp)", "End (bp)", "Strand",
    "Identity (%)", "Coverage (%)", "Database"
]
export["Length (bp)"] = export["End (bp)"] - export["Start (bp)"]
export = export.sort_values("Start (bp)")

# Write to Excel with conditional formatting
with pd.ExcelWriter("plasmid_features.xlsx", engine="openpyxl") as writer:
    export.to_excel(writer, sheet_name="Features", index=False)

print(f"Exported {len(export)} features to plasmid_features.xlsx")

Expected Outputs

Output File	Format	Description
plasmid_annotated.gb	GenBank	Sequence with annotated features; importable into SnapGene, Benchling, Geneious, ApE, BioPython
plasmid_map.html	HTML	Self-contained interactive circular plasmid map (Bokeh); shareable without a server
all_features.csv	CSV	Tabular feature list with columns: Feature, Feature_type, start, end, strand, pct_identity, pct_query_cov, database
high_confidence_features.csv	CSV	Filtered subset with identity >= 95% and coverage >= 90%
all_plasmids_features.csv	CSV	Batch mode: aggregated features across all plasmids with a plasmid column

Troubleshooting

Problem	Cause	Solution
FileNotFoundError: blastn not found	BLAST+ not on PATH	Install via conda: conda install -c bioconda blast; or via package manager: brew install blast (macOS) / apt install ncbi-blast+ (Linux)
No features detected	Sequence is too short, wrong database, or non-standard bases	Verify sequence length >= 500 bp; try a different db (e.g., "fpbase" for fluorescent protein vectors); check for ambiguous bases with validate_plasmid()
Annotations wrap incorrectly at position 0	Sequence treated as linear when it is circular	Set linear=False (default); this enables circular BLAST to catch features that span the sequence origin
HTML map renders blank	bokeh version mismatch	Upgrade: pip install --upgrade bokeh; pLannotate requires Bokeh >=2.4
Low identity hits for known features	Feature sequence has been mutated or codon-optimized	Lower blast_identity_threshold to 85–90%; add a note that these are diverged homologs
MemoryError or very slow annotation	Sequence > 50 kb or BLAST database not indexed	Split large sequences into sub-regions; ensure the internal pLannotate database index exists (reinstall if needed)
GenBank file not parsed by SnapGene	Non-standard feature type labels	Open in Geneious or BioPython first; check for special characters in feature qualifiers

References

• pLannotate GitHub: mmcguffi/pLannotate — source code, issue tracker, and installation instructions
• McGuffi M et al. (2021) Nucleic Acids Research 49(W1): W516–W522 — original pLannotate paper describing the BLAST-based annotation pipeline and curated feature database
• pLannotate PyPI: plannotate — package metadata, version history, and pip install info
• Addgene plasmid repository — primary source for the curated feature library used by pLannotate
• BioPython SeqIO documentation — parsing and manipulating GenBank output files