Skip to main content

molecular-biology

Molecular biology techniques including PCR, cloning, sequencing, gene expression, CRISPR, and cell culture for biotechnology applications.

Ir a la instalación

Datos de origen

Repositorio
NeuralBlitz/Agent-Gateway
Última actividad en el origen
9 de abril de 2026 a las 10:58
Idioma detectado de SKILL.md
inglés
Estrellas
1
Forks
0

Opciones de instalación

De forma predeterminada está seleccionado el prompt que primero revisa el origen. Puedes cambiar a un comando directo o descargar una copia local.

Revisa los archivos de origen

Lee SKILL.md y los archivos complementarios que muestra SkillsMP antes de decidir si quieres instalarlo.

Mostrando SKILL.md

SKILL.md
Instrucciones de origen · Vista previa de solo lectura
name
Molecular Biology
description
Molecular biology techniques including PCR, cloning, sequencing, gene expression, CRISPR, and cell culture for biotechnology applications.
license
MIT
compatibility
python>=3.8
audience
molecular-biologists, biochemists, geneticists, researchers
category
biology
# Molecular Biology ## What I Do I provide comprehensive molecular biology tools including PCR design, cloning strategies, DNA sequencing analysis, gene expression quantification, CRISPR guide design, and cell culture calculations for biotechnology applications. ## When to Use Me - PCR primer design - Cloning strategy planning - DNA sequence analysis - Gene expression studies - CRISPR genome editing - Vector construction ## Core Concepts - **PCR**: Primers, annealing, extension, cycle number - **Cloning**: Restriction enzymes, ligation, transformation - **Sequencing**: Sanger, NGS, read quality, assembly - **Gene Expression**: RT-qPCR, RNA-Seq, normalization - **CRISPR**: gRNA design, off-target prediction - **Transformation**: Efficiency, selection markers - **Protein Expression**: Promoters, vectors, purification - **Flow Cytometry**: Fluorescence, cell sorting ## Code Examples ### PCR Calculations ```python def calculate_tm(sequence): if len(sequence) < 14: return 2 * (sequence.count('A') + sequence.count('T')) + 4 * (sequence.count('G') + sequence.count('C')) return 64.9 + 41 * (sequence.count('G') + sequence.count('C') - 16.4) / len(sequence) def recommended_annealing_temp(forward, reverse): Tm_f = calculate_tm(forward) Tm_r = calculate_tm(reverse) return (Tm_f + Tm_r) / 2 - 5 def optimal_gc_content(sequence): return (sequence.count('G') + sequence.count('C')) / len(sequence) * 100 def amplicon_size(forward, reverse, template): return len(forward) + len(reverse) forward = "ATGAGTGTGCTG" reverse = "TTACACACACCA" print(f"Tm (forward): {calculate_tm(forward):.1f}°C") print(f"Annealing temp: {recommended_annealing_temp(forward, reverse):.1f}°C") ``` ### Primer Design ```python PRIMER_CONSTRAINTS = { 'min_length': 18, 'max_length': 25, 'min_tm': 55, 'max_tm': 65, 'max_gc': 60, 'min_gc': 40, 'max_self_complementarity': 4, 'max_3end_gc': 3 } def validate_primer(sequence): errors = [] gc = optimal_gc_content(sequence) if len(sequence) < PRIMER_CONSTRAINTS['min_length']: errors.append(f"Too short: {len(sequence)}") if len(sequence) > PRIMER_CONSTRAINTS['max_length']: errors.append(f"Too long: {len(sequence)}") if gc < PRIMER_CONSTRAINTS['min_gc']: errors.append(f"GC too low: {gc:.1f}%") if gc > PRIMER_CONSTRAINTS['max_gc']: errors.append(f"GC too high: {gc:.1f}%") return {'valid': len(errors) == 0, 'errors': errors} def find_primers(target_sequence, product_size_range): potential_primers = [] for i in range(len(target_sequence) - 17): fwd = target_sequence[i:i+18] gc = optimal_gc_content(fwd) if 40 <= gc <= 60: potential_primers.append(('forward', i, fwd)) return potential_primers print(f"Primer validation: {validate_primer('ATGCGATCGATCGATCG')}") ``` ### Gene Expression Analysis ```python def delta_delta_ct_method(ct_treated, ct_control, ref_treated, ref_control): dct_treated = ct_treated - ref_treated dct_control = ct_control - ref_control ddct = dct_treated - dct_control fold_change = 2 ** (-ddct) return fold_change, ddct def rpkm_normalization(mapped_reads, gene_length, total_reads): return mapped_reads / (gene_length / 1000 * total_reads / 1e6) def tpm_normalization(mapped_reads, gene_length, rpkm_sum): rpkm = rpkm_normalization(mapped_reads, gene_length, sum(mapped_reads)) return (rpkm / rpkm_sum) * 1e6 ct_gene = 22.5 ct_ref = 18.2 fold_change, ddct = delta_delta_ct_method(ct_gene, 25.0, ct_ref, 17.8) print(f"Fold change: {fold_change:.2f}x") ``` ### CRISPR gRNA Design ```python PAM_SEQUENCE = "NGG" def find_spCas9_sites(sequence): sites = [] for i in range(len(sequence) - 2): motif = sequence[i:i+3] if motif[1:] == "GG": guide = sequence[i:i+20] sites.append({ 'position': i, 'gRNA': guide, 'PAM': motif, 'score': predict_guide_score(guide) }) return sorted(sites, key=lambda x: x['score'], reverse=True) def predict_guide_score(gRNA): scores = { 'G': 0.5, 'C': 0.5, 'A': 0.3, 'T': 0.2, 'GG': 0.2, 'CC': 0.2, 'AA': 0.1, 'TT': 0.1 } score = 0 for i in range(len(gRNA) - 1): dinuc = gRNA[i:i+2] score += scores.get(dinuc, 0) return score def check_off_targets(gRNA, genome, mismatch_limit=3): off_targets = [] for i in range(len(genome) - len(gRNA) + 1): mismatches = sum(1 for j in range(len(gRNA)) if genome[i+j] != gRNA[j]) if mismatches <= mismatch_limit: off_targets.append({'position': i, 'mismatches': mismatches}) return off_targets sequence = "ATGCGTAGCTAGCTAGCTAGCGGATCC" sites = find_spCas9_sites(sequence) print(f"Found {len(sites)} potential gRNA sites") ``` ### Cloning Calculations ```python def calculate_ligation_efficiency(insert_conc, vector_conc, insert_size, vector_size): insert_moles = insert_conc / insert_size vector_moles = vector_conc / vector_size molar_ratio = insert_moles / vector_moles return min(molar_ratio / 3, 1.0) # 3:1 molar ratio recommended def calculate_transformation_efficiency(colonies, volume_plated, dilution_factor, DNA_amount): cfu_per_µg = colonies * dilution_factor * (1000 / volume_plated) / DNA_amount return cfu_per_µg def digest_calculation(DNA_amount, units_enzyme, incubation_time): units_per_µg = units_enzyme / DNA_amount return { 'units_per_µg': units_per_µg, 'suggested_incubation': f"{max(incubation_time, 60)} min at 37°C" } insert_ng, vector_ng = 50, 100 insert_bp, vector_bp = 500, 3000 eff = calculate_ligation_efficiency(insert_ng/500, vector_ng/3000, 500, 3000) print(f"Ligation efficiency: {eff:.2f}") ``` ## Best Practices 1. **Primer Design**: Avoid hairpins and dimers 2. **qPCR**: Include technical replicates 3. **CRISPR**: Validate off-target effects 4. **Controls**: Include positive and negative controls 5. **Replication**: Multiple biological replicates ## Common Patterns ```python # Codon usage optimization CODON_USAGE = { 'A': ['GCT', 'GCC', 'GCA', 'GCG'], 'K': ['AAA', 'AAG'] } def optimize_codon_usage(sequence, host='E.coli'): optimized = '' for aa in translate_dna(sequence): best_codon = max(CODON_USAGE.get(aa, [sequence[i:i+3]])) optimized += best_codon return optimized # Sanger sequencing trace analysis def analyze_trace_quality(trace_file): peak_heights = extract_peak_heights(trace_file) return { 'Q20_bases': sum(1 for h in peak_heights if h > 100), 'average_quality': np.mean(peak_heights) } ``` ## Core Competencies 1. PCR and primer design 2. Gene expression quantification 3. CRISPR guide RNA design 4. Cloning and transformation 5. Sequence analysis and assembly
Ver en GitHub