Validates chosen PCR/qPCR oligos for intramolecular thermodynamic liabilities with primer3-py - hairpins, self-dimers, cross-dimers (calc_hairpin/homodimer/heterodimer), and 3'-end stability (calc_end_stability) - returning ThermoResult dG/Tm and ASCII structures. Covers why a "dimer-free" verdict is a PREDICTION at the supplied salt/Mg/dNTP/oligo conditions and temp_c (so the same primer is fine or dimer-prone depending on conditions), why a 3'-END dimer or hairpin is the lethal class (polymerase-extendable into primer-dimer) so structures are ranked by dG at the annealing temperature and 3'-end involvement rather than global Tm, that ThermoResult dG is in cal/mol not kcal/mol, and that .structure_found must gate the numbers. Use when checking primer pairs before ordering, troubleshooting primer-dimers or smears, or screening oligos for secondary structure. Genome off-target/mispriming is primer-specificity; design is primer-basics; probe assays are qpcr-primers.
Installer avec Codex ou Claude Copiez ce prompt, collez-le dans Codex, Claude ou un autre assistant, puis laissez-le vérifier la page du skill et l'installer pour vous.
Une commande directe contourne le prompt de vérification. Examinez la source avant de l'exécuter.
Validates chosen PCR/qPCR oligos for intramolecular thermodynamic liabilities with primer3-py - hairpins, self-dimers, cross-dimers (calc_hairpin/homodimer/heterodimer), and 3'-end stability (calc_end_stability) - returning ThermoResult dG/Tm and ASCII structures. Covers why a "dimer-free" verdict is a PREDICTION at the supplied salt/Mg/dNTP/oligo conditions and temp_c (so the same primer is fine or dimer-prone depending on conditions), why a 3'-END dimer or hairpin is the lethal class (polymerase-extendable into primer-dimer) so structures are ranked by dG at the annealing temperature and 3'-end involvement rather than global Tm, that ThermoResult dG is in cal/mol not kcal/mol, and that .structure_found must gate the numbers. Use when checking primer pairs before ordering, troubleshooting primer-dimers or smears, or screening oligos for secondary structure. Genome off-target/mispriming is primer-specificity; design is primer-basics; probe assays are qpcr-primers.
tool_type
python
primary_tool
primer3-py
Version Compatibility
Reference examples tested with: primer3-py 2.3+.
Before using code patterns, verify installed versions match. If versions differ:
Python: pip show primer3-py then help(primer3.calc_heterodimer) to check signatures
If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.
Primer Validation -- Thermodynamic Self-Structure of the Chosen Oligos
"Are these primers free of dimers and hairpins?" -> Predict the most stable intramolecular and inter-primer structures and judge them at the reaction conditions -- because a structure's harm is set by its dG at the annealing temperature and by whether it ties up the 3' end, not by a single global score.
Python: primer3.calc_hairpin(seq), calc_homodimer(seq), calc_heterodimer(seq1, seq2), calc_end_stability(seq1, seq2) return a ThermoResult with .tm, .dg, .structure_found.
The Single Most Important Modern Insight -- A "Dimer-Free" Verdict Is a Prediction at the Conditions Supplied, and the 3' End Is What Kills the Reaction
These are predictions, not facts.calc_hairpin/calc_homodimer/calc_heterodimer compute a dG/Tm under a specific monovalent/divalent/dNTP/oligo concentration and an evaluation temperature (temp_c). The same primer can read "fine" at default 37 C / default salt and "dimer-prone" at the real annealing temperature and Mg2+. Validate at the conditions and temp_c of the actual reaction, or the verdict is decorative.
The 3' end is the lethal locus. A dimer or hairpin that pairs the primer's 3' end is polymerase-EXTENDABLE: it gets turned into primer-dimer that amplifies exponentially, consumes reagents, and (in SYBR qPCR) generates competing signal. A structure with a more negative GLOBAL dG but a free 3' end is far less harmful. So do NOT rank by global dG or global Tm -- inspect 3'-end involvement (calc_end_stability and the ASCII structure) and judge at the annealing temperature.
Read the units and the gate.ThermoResult.dg, .dh are in cal/mol (and .ds in cal/(K.mol)) -- a value of -6000 is -6 kcal/mol, so divide by 1000 before comparing to kcal/mol heuristics. Always check .structure_found first: if no structure formed, the .tm/.dg are not a real duplex.
The Three Structures, and Why They Differ
Hairpin (intramolecular): the primer folds on itself; harmful mainly when it sequesters the 3' end or raises effective Tm enough to block template annealing.
Homodimer (self-dimer): two copies of one primer pair; common with self-complementary or palindromic primers.
Heterodimer (cross-dimer): the forward and reverse primers pair with each other. A primer can be individually clean and still cross-dimer with its partner, so the pair must be checked explicitly -- this is the dimer most often missed.
Tool Taxonomy
Function
Citation
Mechanism / role
When
calc_hairpin(seq)
Untergasser 2012 Nucleic Acids Res 40:e115
most stable self-fold via thermodynamic alignment (ntthal)
screen a single primer/probe for hairpins
calc_homodimer(seq)
Untergasser 2012 Nucleic Acids Res 40:e115
most stable self-self duplex
self-dimer of one oligo
calc_heterodimer(s1, s2)
Untergasser 2012 Nucleic Acids Res 40:e115
most stable cross duplex of two oligos
forward-vs-reverse (and probe) cross-dimer
calc_end_stability(s1, s2)
SantaLucia & Hicks 2004 Annu Rev Biophys 33:415
dG of the 3' end of s1 annealing to s2
the 3'-anchored, extendable-dimer question
calc_*_tm (float)
Untergasser 2012 Nucleic Acids Res 40:e115
the .tm only, no structure object
fast high-throughput screening
calc_tm(seq)
SantaLucia 1998 PNAS 95:1460
nearest-neighbor Tm vs perfect complement
the pair Tm-match check
Decision Tree by Scenario
Scenario
Recommended
Why
Standard pre-order check of a pair
calc_hairpin/homodimer on each + calc_heterodimer on the pair, at reaction conditions and temp_c = Ta
the four-call panel that catches self-structure
Suspect a primer-dimer artifact (gel, low-Tm melt peak)
calc_heterodimer + calc_end_stability, read the ASCII structure for 3'-end pairing
3'-end dimers are extendable; that is the artifact source. A dimer that appears only at LOW template is diagnostic -- with scarce target, primer-primer collisions win the kinetic competition
Screening hundreds of oligos
calc_hairpin_tm/calc_homodimer_tm (floats)
fast triage; promote flagged ones to full ThermoResult
One primer designed with a 5' tail
run the calls on the FULL tailed oligo
the tail exists physically (palindromic sites/Gibson arms dimerize)
Pair anneals unevenly / one strand dominates
compare calc_tm of the two primers
a Tm mismatch >2-3 C, not a dimer, is the cause
"Will it amplify only the target?"
-> primer-specificity
that is genome off-target, a different question and toolset
Default when uncertain: run the four-call panel at the real salt/Mg/dNTP/oligo concentrations with temp_c set to the annealing temperature, flag any structure whose dG is strongly negative at Ta, and weight 3'-end involvement most.
Validate a Primer Pair at Reaction Conditions
Goal: Decide whether a chosen forward/reverse pair will misbehave through hairpins or dimers in the actual reaction, with the 3' end weighted appropriately.
Approach: Run hairpin and homodimer on each primer and heterodimer on the pair, all at the reaction's salt/Mg/dNTP/oligo concentrations and with temp_c set to the annealing temperature; gate every result on .structure_found; additionally compute calc_end_stability on the heterodimer to expose 3'-anchored (extendable) dimers; compare the two primer Tms for a match.
import primer3
fwd, rev = 'GTCTCCTCTGACTTCAACAGCG', 'ACCACCCTGTTGCTGTAGCCAA'
COND = dict(mv_conc=50.0, dv_conc=3.0, dntp_conc=0.8, dna_conc=250.0, temp_c=60.0) # match the qPCR/PCR reaction + Tadefflag(label, res):
if res.structure_found:
print(f'{label}: Tm={res.tm:.1f}C dG={res.dg/1000:.2f} kcal/mol') # dg is cal/mol -> /1000else:
print(f'{label}: no structure')
for name, seq in [('fwd', fwd), ('rev', rev)]:
flag(f'{name} hairpin', primer3.calc_hairpin(seq, **COND))
flag(f'{name} homodimer', primer3.calc_homodimer(seq, **COND))
flag('heterodimer', primer3.calc_heterodimer(fwd, rev, **COND))
end = primer3.calc_end_stability(fwd, rev, **COND) # 3'-end-anchored stability = the extendable-dimer riskprint(f"3'-end stability dG={end.dg/1000:.2f} kcal/mol")
dtm = abs(primer3.calc_tm(fwd, **{k: COND[k] for k in ('mv_conc','dv_conc','dntp_conc','dna_conc')})
- primer3.calc_tm(rev, **{k: COND[k] for k in ('mv_conc','dv_conc','dntp_conc','dna_conc')}))
print(f'pair Tm difference={dtm:.1f}C')
Reading the Result: dG, the 3' End, and the Structure
ThermoResult.dg is in cal/mol (divide by 1000 for kcal/mol). More negative = more stable = more concerning. But two structures with similar Tm can have very different dG at the annealing temperature, and the structure's own Tm is just where its dG crosses zero -- so judge by dG at temp_c = Ta, not by Tm. Print res.ascii_structure (or res.ascii_structure_lines) to SEE where the duplex sits: a dimer that pairs the recessed 3' ends is extendable and disqualifying even at modest dG, while a stronger structure with free 5'/internal pairing only transiently lowers free primer. calc_end_stability(fwd, rev) isolates exactly the 3'-end-of-fwd-against-rev stability, which is the right number for "will this dimer extend." It scores the 3' end of the FIRST argument, so check both directions (also calc_end_stability(rev, fwd)) -- either primer's 3' end can anchor the extendable dimer.
Per-Method Failure Modes
Ranking dimers by global dG or Tm
Trigger: Accepting/rejecting a structure on its overall dG or Tm. Mechanism: a weak dimer that locks the 3' ends is extended into artifact, while a strong dimer with free 3' ends is benign. Symptom: a "passing" pair still produces primer-dimer; a "failing" pair amplifies fine. Fix: inspect 3'-end involvement (calc_end_stability, ASCII structure) and weight it above whole-molecule dG.
Validating at the wrong temperature/conditions
Trigger: Using default temp_c=37 and default salt instead of the reaction's Ta and Mg2+. Mechanism: structure stability is strongly condition-dependent; a structure that melts below Ta is harmless. Symptom: false alarms (or false passes) that do not match the bench. Fix: set temp_c to the annealing temperature and pass the real mv/dv/dntp/dna concentrations.
Trusting dG without a structure
Trigger: Reading .dg/.tm without checking .structure_found. Mechanism: when no structure forms the fields are not a real duplex. Symptom: nonsense or contradictory numbers. Fix: gate every result on .structure_found before reporting.
Unit confusion (cal vs kcal)
Trigger: Comparing .dg directly to a kcal/mol threshold. Mechanism: primer3-py reports dG in cal/mol, so -6000 is -6 kcal/mol. Symptom: thresholds off by 1000x; everything looks catastrophic or fine. Fix: divide .dg by 1000 before comparing.
Validating only the binding core of a tailed primer
Trigger: Checking the template-binding portion of a primer that carries a 5' tail. Mechanism: the full oligo (tail included) is what physically exists; palindromic restriction sites and complementary Gibson arms dimerize. Symptom: clean validation, dimers on the bench. Fix: run the calls on the FULL tailed oligo.
Quantitative Thresholds
These are FLAGGING heuristics for inspection, not hard cutoffs; they are condition-dependent (salt, Mg2+, primer concentration, Ta). Read the structure and judge at Ta before accepting or rejecting.
Threshold
Source
Rationale
Hairpin Tm at least ~10 C below Ta
SantaLucia & Hicks 2004 Annu Rev Biophys 33:415
a hairpin that melts well below the anneal step is largely denatured
Dimer dG flag if more negative than ~ -6 to -9 kcal/mol
--
common practice line; below ~ -9 generally rejected; condition-dependent
3'-END dimer dG: be stricter, flag ~ -3 to -5 kcal/mol
Kwok 1990 Nucleic Acids Res 18:999
3'-anchored dimers are extendable, so weight them above global dG
Pair Tm difference <= 2 C
Koressaar & Remm 2007 Bioinformatics 23:1289
matched Tm so both primers anneal at one Ta
Evaluate at temp_c = annealing temperature
SantaLucia & Hicks 2004 Annu Rev Biophys 33:415
dG at Ta, not at 37 C, is the harm-relevant quantity
Common Errors
Error / symptom
Cause
Solution
AttributeError: calcHeterodimer
camelCase deprecated since primer3-py 1.0.0
use snake_case calc_heterodimer
Validation disagrees with the bench
default temp_c/salt, not the real reaction
pass reaction mv/dv/dntp/dna and temp_c = Ta
A "clean" pair still makes primer-dimer
judged by global dG, missed the 3' end
check calc_end_stability and the ASCII structure
dG threshold seems 1000x off
.dg is cal/mol, not kcal/mol
divide by 1000 before comparing
.tm/.dg look meaningless
no structure formed
gate on .structure_found
Pair amplifies one strand only
Tm mismatch, not a dimer
compare calc_tm of the two primers; redesign Tm-matched (primer-basics)
References
Untergasser A, Cutcutache I, Koressaar T, et al. 2012. Primer3 - new capabilities and interfaces. Nucleic Acids Res 40:e115.
SantaLucia J Jr, Hicks D. 2004. The thermodynamics of DNA structural motifs. Annu Rev Biophys Biomol Struct 33:415-440.
SantaLucia J Jr. 1998. A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics. PNAS 95:1460-1465.
Koressaar T, Remm M. 2007. Enhancements and modifications of primer design program Primer3. Bioinformatics 23:1289-1291.
Kwok S, Kellogg DE, McKinney N, et al. 1990. Effects of primer-template mismatches on the polymerase chain reaction: human immunodeficiency virus type 1 model studies. Nucleic Acids Res 18:999-1005.
Related Skills
primer-basics - Design Tm-matched primer pairs (redesign if validation fails)
primer-specificity - Genome-wide off-target / in-silico PCR (a different question)
qpcr-primers - Co-design qPCR primers and probes, including probe self-structure
sequence-manipulation/seq-objects - Reverse-complement and assemble tailed oligos to validate