Skip to main content

bio-crispr-screens-library-design

Designs pooled sgRNA libraries for CRISPR knockout, interference (CRISPRi), activation (CRISPRa), Cas12a multiplex, base-editor, and prime-editor screens. Covers on-target scoring (Rule Set 2, Azimuth, DeepSpCas9, CRISPRon), off-target scoring (CFD, MIT), TSS-relative positioning for CRISPRi/a (Horlbeck, Dolcetto, Calabrese), PAM-variant chemistries, control-guide composition, oligo cloning architecture, and library QC. Use when choosing a genome-wide library (GeCKOv2 vs Avana vs Brunello vs TKOv3 vs Inzolia), designing a focused or paralog-focused custom library, picking CRISPRi vs CRISPRa TSS windows, deciding control-guide proportions, or diagnosing library skew and dropout in a freshly cloned pool.

소스 정보

저장소
GPTomics/bioSkills
최근 소스 활동
2026년 7월 25일 09:16
감지된 SKILL.md 언어
영어
스타
1,209
포크
251

설치 방법

기본적으로 소스를 먼저 확인하는 Prompt가 선택됩니다. 직접 명령으로 전환하거나 로컬 사본을 다운로드할 수도 있습니다.

소스 파일 검토

설치 여부를 결정하기 전에 SKILL.md와 SkillsMP에 표시된 보조 파일을 읽어 보세요.

파일 탐색기
3 개 파일

SKILL.md 표시 중

SKILL.md
소스 지침 · 읽기 전용 미리보기
name
bio-crispr-screens-library-design
description
Designs pooled sgRNA libraries for CRISPR knockout, interference (CRISPRi), activation (CRISPRa), Cas12a multiplex, base-editor, and prime-editor screens. Covers on-target scoring (Rule Set 2, Azimuth, DeepSpCas9, CRISPRon), off-target scoring (CFD, MIT), TSS-relative positioning for CRISPRi/a (Horlbeck, Dolcetto, Calabrese), PAM-variant chemistries, control-guide composition, oligo cloning architecture, and library QC. Use when choosing a genome-wide library (GeCKOv2 vs Avana vs Brunello vs TKOv3 vs Inzolia), designing a focused or paralog-focused custom library, picking CRISPRi vs CRISPRa TSS windows, deciding control-guide proportions, or diagnosing library skew and dropout in a freshly cloned pool.
tool_type
mixed
primary_tool
CRISPOR
## Version Compatibility Reference examples tested with: CRISPOR 5.01+, BioPython 1.83+, pandas 2.2+, numpy 1.26+, Azimuth 2.0+ (Doench 2016), CRISPRon 1.0+ (Xiang 2021), DeepSpCas9 1.0+ (Kim 2019). Before using code patterns, verify installed versions match. If versions differ: - CLI: `crispor.py --help` from the crisporWebsite clone - Python: Azimuth has no console script; call `azimuth.model_comparison.predict(...)` If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying. ## sgRNA Library Design **"Design a CRISPR library for my screen"** -> Pick a chemistry (Cas9 KO, CRISPRi, CRISPRa, Cas12a, base or prime editor), score candidate guides for on-target activity and off-target liability, position them relative to gene/TSS, add appropriate controls, lay out the oligo for synthesis, and validate the cloned pool. - Python: `crispor.py` (web + CLI) for batch genome-wide guide scoring with CFD+MIT off-target - Python: `azimuth` (Microsoft Research) for Rule Set 2 on-target predictions (Brunello-style) - Python: `CRISPRon`, `DeepSpCas9` for modern deep-learning predictors - R: `crisprDesign` (Bioconductor) for integrated annotation-aware design ## Library Chemistry Decision Tree | Goal | Chemistry | Canonical library | Guides/gene | TSS / target window | |------|-----------|-------------------|-------------|---------------------| | Loss-of-function essentiality, fitness | SpCas9 KO | Brunello, TKOv3, Avana | 4 (Brunello), 4 (TKOv3), 6 (Avana) | Constitutive exons, prefer aa 5-65% from N-terminus | | Knockdown of non-cuttable genes, dosage-sensitive | dCas9-KRAB (CRISPRi) | Dolcetto, Horlbeck v2 | 6 (Dolcetto), 5 (Horlbeck) | Optimum +25 to +75 downstream of FANTOM5 TSS, searched out to -50/+300 (Dolcetto, Sanson 2018); -25 to +500 (Horlbeck v2) | | Gain-of-function, gene activation | dCas9-VP64 / SAM / SunTag (CRISPRa) | Calabrese, Horlbeck-CRISPRa | 6 (Calabrese), 5 (Horlbeck) | -150 to -75 from TSS (Calabrese); -550 to -25 (Horlbeck v2) | | Paralog buffering, GI screens | enAsCas12a multiplex | Inzolia, in4mer | 4-guide arrays | Constitutive exons | | Variant function, SNV scanning | CBE / ABE | Custom tiling library | Tile editing windows | Editing window pos 4-8 from PAM-distal end | | Precise edit, indel-free | Prime editor | Custom PRIDICT-designed | Tile pegRNAs | Anywhere with NGG PAM within 30 nt of edit | **Fails when:** - CRISPRi/a targeting wrong TSS: any TSS without FANTOM5 CAGE evidence is suspect; guides positioned against the wrong TSS lose most of their knockdown. - Cas9 KO of essential paralogs: single-KO buffering hides paralog-redundant essentials (42% of constitutively expressed genes never score, Dede 2020); switch to Cas12a multiplex. - Base editor over an exon-intron boundary: editing-window bystanders create splice variants instead of the intended SNV. ## On-Target Scoring: Algorithmic Taxonomy | Predictor | Year | Training set | Strengths | Fails when | |-----------|------|--------------|-----------|------------| | Doench Rule Set 1 | 2014 | Flow-sorted GFP+ knockouts | Simple, interpretable | Limited training data; sub-optimal at >NGG context | | Doench Rule Set 2 / Azimuth 2.0 | 2016 | 1,841 flow-cytometry guides (Doench 2014) plus new guides tiling additional genes | Gold-standard for SpCas9; basis of Brunello | Trained on dropouts; under-predicts efficacy for nuclear-localized targets | | DeepSpCas9 | 2019 | 12,832 synthetic targets integrated in HEK293T | Spearman ~0.77 vs measured indel frequency on held-out data | Black-box; sensitive to chromatin/context features it wasn't trained on | | CRISPRon | 2021 | High-throughput indel sequencing | Best for therapeutic-grade target nomination | Slow per-guide; over-fits to its specific cell line | | DeepHF | 2019 | ~171k guides in HEK293T (WT 55,604; eSpCas9(1.1) 58,167; HF1 56,888) | Separate model per enzyme variant, including WT | Pick the model matching the enzyme actually used | **Reconciliation:** When predictors disagree, prefer the model whose training cell line matches the screen line (DeepSpCas9 was trained on synthetic targets integrated in HEK293T). For Brunello selection, Azimuth/Rule Set 2 is sufficient because the library was built with it -- introducing a different scorer creates apples-to-oranges ranking with the original library. ## Off-Target Scoring | Score | Year | Math | Cutoff convention | |-------|------|------|--------------------| | MIT (Hsu) | 2013 | Position-weighted mismatch penalty | Specificity score 0-100, higher is better; CRISPOR treats >=50 as a good guide | | CFD (Doench) | 2016 | Position+nucleotide-specific penalty fit on Brunello | Per-site CFD >0.2 counts a candidate off-target (Doench 2016); CRISPOR's aggregate CFD specificity score is 0-100, higher is better | | Elevation | 2018 | ML on CFD + mismatch positions | Tighter than CFD | CFD remains the default for genome-wide library design. **Critical pitfall:** CFD penalizes only mismatches, not bulges; for ≤1 mismatch + 1-bp bulge off-targets, validate empirically with GUIDE-seq or CIRCLE-seq. CRISPOR reports both the MIT (Hsu) and CFD guide specificity scores in a single output. ## Score and Rank sgRNAs for a Target Gene **Goal:** Generate ranked sgRNA candidates for a single gene, jointly scored on on-target activity (Rule Set 2 / Azimuth) and off-target liability (CFD). **Approach:** Identify all PAM-adjacent 20-nt protospacers in the target gene's coding sequence, retain only those in the first 5-65% of the protein (constitutive-exon convention from Brunello), filter on GC 30-70% and absence of poly-T (≥4 Ts terminates U6), call Azimuth for on-target and CRISPOR for off-target, and select the top N satisfying both criteria. ```python import re import pandas as pd import numpy as np from Bio.Seq import Seq def find_sgrna_candidates(cds_sequence, pam='NGG', guide_length=20): '''Return all protospacer candidates with PAM coordinates on + strand. Caller must filter by exon position and Azimuth/CFD score.''' pam_pattern = re.compile(f'(?=([ACGT]{{{guide_length}}}{pam.replace("N", "[ACGT]")}))') candidates = [] for strand, seq in [('+', cds_sequence), ('-', str(Seq(cds_sequence).reverse_complement()))]: for m in pam_pattern.finditer(seq): spacer = m.group(1)[:guide_length] if 'TTTT' in spacer or spacer.count('G') + spacer.count('C') not in range(6, 15): continue candidates.append({'spacer': spacer, 'strand': strand, 'pos_in_cds': m.start() if strand == '+' else len(seq) - m.start() - 23, 'gc_frac': (spacer.count('G') + spacer.count('C')) / guide_length}) return pd.DataFrame(candidates) def annotate_exon_position(candidates_df, cds_length): '''Filter to protospacers within first 5-65% of CDS (Brunello convention). Reason: N-terminal indels truncate protein; very-N-terminal hits alt initiation; C-terminal hits miss functional domains (Doench 2016 Nat Biotech).''' lo, hi = 0.05 * cds_length, 0.65 * cds_length return candidates_df[(candidates_df['pos_in_cds'] >= lo) & (candidates_df['pos_in_cds'] <= hi)].copy() ``` ## CRISPRi / CRISPRa TSS Targeting **Goal:** Position guides relative to the empirical TSS for maximum knockdown (CRISPRi) or activation (CRISPRa). **Approach:** Resolve TSS from FANTOM5 CAGE peaks (highest-ranked peak per gene; fall back to Ensembl/RefSeq if absent), define the modality-specific window, score candidate spacers in that window with Rule Set 2 plus the Horlbeck/Sanson CRISPRi/a-tailored rules, and select 5-6 guides per gene biased toward the window center. ```python def crispri_window(tss_coord, strand='+'): '''Dolcetto convention: search -50 to +300 around the FANTOM5 highest-rank CAGE peak. Reason: Sanson 2018 found +25 to +75 nt downstream of the TSS optimal for CRISPRi, so rank candidates toward that band; the search is relaxed outward to fill the per-gene guide quota when poorly-annotated TSSs leave too few candidates.''' if strand == '+': return (tss_coord - 50, tss_coord + 300) return (tss_coord - 300, tss_coord + 50) def crispra_window(tss_coord, strand='+'): '''Calabrese convention: -150 to -75 upstream of TSS. Reason: dCas9-VP64 (and SAM, SunTag) activate maximally when bound just upstream of Pol II loading. Horlbeck v2 CRISPRa uses -550 to -25 (broader, lower per-guide signal). For SAM, prefer Calabrese tightness; for SunTag, Horlbeck width is acceptable.''' if strand == '+': return (tss_coord - 150, tss_coord - 75) return (tss_coord + 75, tss_coord + 150) ``` **Critical nuance:** Cell-type-specific TSSs differ from the FANTOM5 consensus in ~15% of genes. For tissue-specific screens (e.g., neuron, hepatocyte), re-derive TSSs from a matched CAGE / GRO-seq / PRO-seq dataset before locking guide positions, or knockdown efficiency drops several-fold. The single most common cause of "weak" CRISPRi hits is mis-positioned guides against an alternative TSS. ## Genome-Wide Library Selection | Library | Year | Modality | Size (genes x guides) | sgRNA rules | Notable | |---------|------|----------|-----------------------|-------------|---------| | GeCKOv2 | 2014 | Cas9 KO | ~19k x 6 (~123k) | Exon position + off-target specificity (predates Rule Set 1) | Older; legacy datasets still use it | | Avana | 2016 | Cas9 KO | 110,257 as published; DepMap screens a ~4-guide subset (Meyers 2017: 70,086 after filtering, 17,670 genes) | Rule Set 1 | Still the Broad's primary Cas9 library; CERES->Chronos changed in 2021, not the library | | Brunello | 2016 | Cas9 KO | ~19k x 4 (~77k) | Rule Set 2 + CFD | Modern standard for new screens | | TKOv3 | 2017 | Cas9 KO | ~18k x 4 (~71k) | Hart on/off-target | Bagel/BAGEL2-optimized | | Humagne | 2020 | enAsCas12a | ~19.8k x 1 dual-guide construct (~20k per set) | enAsCas12a rules | Compact Cas12a sets C and D | | Horlbeck CRISPRi v2 | 2016 | dCas9-KRAB | ~18k x 5 (~104k) | Horlbeck CRISPRi rules | First-gen, still widely used | | Dolcetto | 2018 | dCas9-KRAB | ~19k x 3 per set (114,061 across Sets A+B) | Horlbeck + Rule Set 2 | Modern CRISPRi standard | | Horlbeck CRISPRa | 2016 | dCas9-VP64 | ~18k x 5 (~104k) | Horlbeck CRISPRa rules | Original CRISPRa | | Calabrese | 2018 | dCas9-VP64 | ~18.9k x 3 per set (113,238 across Sets A+B) | Tight TSS window | Modern CRISPRa standard | | Inzolia | 2024 | enAsCas12a | ~49k arrays: 19,687 genes (2 arrays each) plus ~4,435 paralog pairs | enAsCas12a rules | Paralog-pair multiplex; ~30% smaller than a typical Cas9 library | | in4mer | 2024 | Cas12a (4-guide) | Custom | enAsCas12a multiplex | Triple/quadruple KO per cassette | **dAUC trajectory (essentiality benchmark):** GeCKOv2 < Avana < Brunello/TKOv3 (Doench 2016 + Hart 2017). Moving from 4 to 6 sgRNAs/gene gives diminishing returns; the larger gain is moving from Rule Set 1 to Rule Set 2. **Cost-coverage tradeoff:** A 77k-guide Brunello at 500x cells/sgRNA needs 38.5M cells in pool, scalable. A 117k-guide Calabrese at 500x needs 59M cells -- often the deciding factor against CRISPRa for difficult-to-grow lines. ## PAM Variants and Alternative Cas Enzymes | Enzyme | PAM | Spacer length | Best for | |--------|-----|---------------|----------| | SpCas9 (WT) | NGG | 20 nt | Standard pooled screens; broadest library support | | eSpCas9, SpCas9-HF1 | NGG | 20 nt | Lower off-target rate; use for therapeutic-grade nomination | | SpCas9-NG | NG | 20 nt | Expanded targeting (~4x coverage); accept lower activity per guide | | SpRY | NRN / NYN | 20 nt | Near-PAMless; coverage at every position; ~50% lower per-guide activity | | SaCas9 | NNGRRT | 21 nt | AAV-packageable (small ORF); rarely used in pooled screens | | AsCas12a, LbCas12a | TTTV | 23 nt | AT-rich regions; staggered cut; lower expression noise | | enAsCas12a (DeWeirdt 2021) | Expanded TTTV + several non-canonical | 23 nt | Combinatorial / paralog screens | **Decision rule:** If the screen requires every possible TSS position (saturation tiling, dense regulatory dissection), use SpRY despite lower activity; otherwise, NGG is best because the on-target predictors were trained on it. ## Control Guides A genome-wide library should include: | Control type | Count | Purpose | |--------------|-------|---------| | Non-targeting (scrambled, no genomic match) | 500-1,000 (~1% of library) | Primary null distribution for CRISPRi/a; safe baseline for normalization | | Safe-harbor (AAVS1, ROSA26-equivalent) | 50-100 | Cas9-only: absorbs cut-toxicity baseline (matters for amplicon-correction) | | Olfactory receptors (presumed non-expressed) | 50-100 | Second null set for orthogonal normalization | | Reference essentials (CEGv2 subset: e.g. RPS3, RPL11, EIF3A, POLR2A) | 50-100 | Internal positive control; QC dropout signal | | Reference non-essentials (NEGv1 subset) | 50-100 | Internal negative control; BAGEL2 calibration | **Critical pitfall:** Using only AAVS1 as the negative control in a Cas9 screen creates a normalization baseline biased toward "any cut is bad." Always add NTCs or non-essentials so that downstream median normalization and PR-AUC against CEGv2 work without baseline-shift artifacts. ## Library Composition for Specialized Screens **Paralog buffering (Cas12a multiplex):** Build 4-guide arrays where positions 1-2 target gene A and positions 3-4 target paralog gene B. Inzolia covers ~4,435 paralog pairs within ~49k arrays. Singleton controls (gene A alone, gene B alone) must be included to score genetic interaction = double_KO_LFC - sum(single_KO_LFC). **Base editor screens (tiling-library design):** Tile NGG-adjacent spacers across exons; ensure editing window (positions 4-8 from PAM-distal end) lands inside coding exons; flag bystander Cs/As in the window for downstream interpretation. Restrict to 50-90% editing efficiency a priori (filter out predicted low-efficacy guides) -- see [[base-editing-analysis]]. **Tiling / regulatory dissection:** Dense (every 5-10 bp) CRISPRi or CRISPRa guides across the candidate region; CRISPRi has broader signal width (good for enhancer discovery) but Cas9-indel tiling has sharper resolution (good for pinpointing critical bases). Pair with CRISPR-SURF deconvolution. ## Oligo Design for Pooled Synthesis **Goal:** Generate the final oligo sequence ready for chip-based synthesis. Vendor limits differ: Twist oligo pools cap at ~300 nt per oligo with no fixed pool size, GenScript's 92K format spans 20-170 nt, and Agilent OLS 244K spans 30-230 nt. **Approach:** Add subpool PCR primers (so multiple sublibraries can share a synthesis array), the BsmBI/Esp3I overhang for golden-gate cloning into LentiGuide-Puro (Addgene 52963) or LentiCRISPRv2, and append the tracrRNA scaffold if the array length permits. ```python def build_oligo(spacer, vector='lentiGuide-Puro', subpool_idx=None): '''Construct final oligo for pooled synthesis. LentiGuide-Puro / LentiCRISPRv2 use BsmBI (Esp3I) with these overhangs: forward: 5'-CACCG[spacer]-3' reverse: 5'-AAAC[revcomp(spacer)]C-3' For chip synthesis, the spacer is flanked by subpool-specific PCR primers.''' subpool_fwd = { 1: 'GGAAAGGACGAAACACCG', # subpool 1 forward primer + BsmBI overhang 2: 'GAGGCACTGGGCAGGTACCG', }.get(subpool_idx, 'GGAAAGGACGAAACACCG') # First 33 nt of the Chen 2013 sgRNA(F+E) optimized scaffold. NOTE: lentiGuide-Puro (#52963) # and lentiCRISPRv2 (#52961) carry the ORIGINAL scaffold; F+E belongs to lentiCRISPRv2-Opti (#163126).
GitHub에서 보기
이 SKILL.md는 매우 커서 SkillsMP가 여기에는 첫 섹션만 미리 보여줍니다. GitHub에서 보기