| name | biopython |
| description | A comprehensive toolbox for computational molecular biology; use it when you need programmatic sequence/structure parsing, batch bioinformatics pipelines, or automated NCBI/BLAST workflows. |
| license | MIT |
| author | AIPOCH |
Source: https://github.com/aipoch/medical-research-skills
When to Use
Use this skill when you need to:
- Batch-process DNA/RNA/protein sequences (translation, reverse complement, statistics) as part of a custom pipeline.
- Parse, validate, convert, or stream large bioinformatics files (FASTA/FASTQ/GenBank/PDB/mmCIF) without loading everything into memory.
- Programmatically query and download records from NCBI (GenBank, PubMed, Gene, Protein) via
Bio.Entrez, respecting rate limits.
- Automate BLAST searches (web or local) and parse results to extract top hits and metadata.
- Build or manipulate phylogenetic trees from alignments or distance matrices (e.g., NJ trees) for downstream analysis.
Note: For quick one-off queries, tools like gget may be more convenient; for multi-service API aggregation, bioservices may be a better fit.
Key Features
- Sequence objects and utilities:
Bio.Seq, Bio.SeqRecord, Bio.SeqUtils (GC fraction, molecular weight, translation, etc.).
- File I/O and format conversion:
Bio.SeqIO, Bio.AlignIO for FASTA/FASTQ/GenBank and alignment formats.
- NCBI access:
Bio.Entrez for esearch, efetch, elink, and structured parsing via Entrez.read.
- BLAST:
Bio.Blast.NCBIWWW for remote BLAST and Bio.Blast.NCBIXML for XML parsing.
- Structural bioinformatics:
Bio.PDB for PDB/mmCIF parsing, hierarchy traversal, and geometry calculations.
- Phylogenetics:
Bio.Phylo and Bio.Phylo.TreeConstruction for tree I/O, distances, and construction.
Reference guides (if present in this repository) can be consulted for deeper module-specific patterns:
references/sequence_io.md
references/alignment.md
references/databases.md
references/blast.md
references/structure.md
references/phylogenetics.md
references/advanced.md
Dependencies
- Python >= 3.8 (Biopython 1.85 supports Python 3)
biopython==1.85
numpy>=1.20 (required by Biopython)
Install:
python -m pip install "biopython==1.85" "numpy>=1.20"
Example Usage
A complete, runnable example that:
- parses a FASTA file,
- computes GC fraction,
- runs a remote BLAST (optional),
- fetches the top hit from NCBI,
- prints basic results.
Create example_biopython_pipeline.py:
from __future__ import annotations
import os
import time
from typing import Optional
from Bio import Entrez, SeqIO
from Bio.SeqUtils import gc_fraction
from Bio.Blast import NCBIWWW, NCBIXML
def configure_entrez() -> None:
"""
NCBI requires an email. An API key increases rate limits.
Set these via environment variables to avoid hardcoding secrets.
"""
email = os.environ.get("NCBI_EMAIL")
if not email:
raise RuntimeError("Set NCBI_EMAIL env var (required by NCBI). Example: export NCBI_EMAIL='you@org.org'")
Entrez.email = email
api_key = os.environ.get("NCBI_API_KEY")
if api_key:
Entrez.api_key = api_key
def read_first_fasta_record(path: str):
with open(path, "r", encoding="utf-8") as handle:
return next(SeqIO.parse(handle, "fasta"))
def blast_top_accession(sequence: str, program: str = "blastn", database: str = "nt") -> Optional[]:
result_handle = NCBIWWW.qblast(program, database, sequence)
blast_record = NCBIXML.read(result_handle)
blast_record.alignments:
blast_record.alignments[].accession
() -> :
Entrez.efetch(db=, =accession, rettype=, retmode=) handle:
handle.read()
() -> :
configure_entrez()
record = read_first_fasta_record()
seq = record.seq
()
()
()
time.sleep()
top_acc = blast_top_accession((seq))
top_acc:
()
()
time.sleep()
fasta_text = fetch_fasta_by_accession(top_acc)
()
(fasta_text)
__name__ == :
main()
Run:
export NCBI_EMAIL="your.email@example.com"
python example_biopython_pipeline.py
Provide an input.fasta in the same directory, e.g.:
>demo
ATCGATCGATCGATCGATCG
Implementation Details
- Streaming I/O for large datasets: Prefer iterator-based parsing (
SeqIO.parse) to avoid loading entire files into memory. Use SeqIO.read only when exactly one record is expected.
- Entrez configuration and rate limits:
- Always set
Entrez.email (NCBI requirement).
- Optionally set
Entrez.api_key to increase request limits.
- In batch jobs, add delays (e.g.,
time.sleep(0.34) as a conservative baseline) and implement retries for transient HTTP failures.
- BLAST considerations:
NCBIWWW.qblast(...) is convenient but can be slow and is not ideal for high-throughput workloads.
- Parse results with
NCBIXML.read(...) (single record) or NCBIXML.parse(...) (multiple records).
- Filter hits by HSP metrics (e-value, identity) by iterating
alignment.hsps.
- Sequence statistics and transformations:
- Use
Bio.SeqUtils.gc_fraction(seq) for GC fraction (returns 0–1).
- Use
seq.translate(table=...) with the correct genetic code table for reproducibility.
- Structure parsing (if used):
- Use
Bio.PDB.PDBParser(QUIET=True) to suppress warnings when appropriate.
- Navigate the SMCRA hierarchy (Structure → Model → Chain → Residue → Atom) for robust traversal and geometry calculations.
- Reproducibility:
- Record key parameters (file formats, translation table, BLAST program/database, e-value thresholds, NCBI query terms).
- Cache downloaded records when iterating to avoid repeated network calls.