bio-clip-seq-clip-deep-learning

name	bio-clip-seq-clip-deep-learning
description	Predict RBP binding from RNA sequence using deep learning models (RBPNet sequence-to-signal, RNAProt RNN, GraphProt2 GCN with structure, DeepCLIP, DeepRiPe multi-modal CNN) for variant-effect prediction, in silico binding-site discovery, model interpretation, and transfer learning from CLIP and RBNS datasets. Use when computational prediction of RBP binding from sequence is needed, evaluating variant effects on binding without further wet-lab experiments, comparing model performance, or training a custom model on ENCODE eCLIP data.
tool_type	python
primary_tool	RBPNet

Version Compatibility

Reference examples tested with: RBPNet (Horlacher et al 2023 github), RNAProt 0.5+, GraphProt2 (Uhl et al 2021 github), DeepCLIP 1.0+ (Gronning 2020), DeepRiPe (Ohler lab), pytorch 2.2+, tensorflow 2.15+, scikit-learn 1.4+, biopython 1.83+, transformers 4.40+ (for RNA foundation models).

Before using code patterns, verify installed versions match. If versions differ:

• Python: pip show <package> then help(module.function) to check signatures
• Frameworks: check pytorch / tensorflow versions; reproducibility depends on framework version

If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.

CLIP-seq Deep Learning

"Predict RBP binding from RNA sequence using deep learning" -> Train or apply neural networks that learn the sequence (and optionally structure) preference of an RBP from CLIP-seq peaks or single-nucleotide crosslink sites. The output is per-base or per-site binding probability for any input sequence, enabling: (a) variant-effect prediction at heterozygous SNPs; (b) in silico binding-site discovery on transcripts not covered by CLIP; (c) systematic comparison across RBPs via shared model architectures; (d) interpretation via attribution / saliency to recover RBP-specific motifs and structural preferences. Modern models (RBPNet 2023) predict per-nucleotide crosslink count distributions rather than binary peak/non-peak, providing single-nt resolution outputs.

• Python (RBPNet sequence-to-CL signal): import rbpnet; model = rbpnet.load_pretrained('RBP_name'); predictions = model.predict(sequence) produces per-base CL count distribution
• Python (RNAProt RNN classifier): RNAProt train -i peaks.bed -t background.bed -g genome.fa -o model/ then RNAProt predict -m model/ -i query_sequences.fa -o predictions.tsv
• Python (GraphProt2 GCN with structure): graphprot2 train -i peaks.bed -bg shuffled.bed -g genome.fa --structure -o model/
• Python (DeepCLIP for binding probability): deepclip --train --train_data train.fa --validation_data val.fa --predict --predict_data test.fa --output_dir output/
• Python (DeepRiPe multi-modal CNN): from deepripe import DeepRiPe; model.train(X_train, y_train); predictions = model.predict(X_test)

The benchmarks (RNAProt paper, 2021): RNAProt AUC 87-89%; DeepCLIP 84-87%; GraphProt 82-84%. RBPNet (2023) is the modern sequence-to-signal model that predicts per-nt CL distributions at single-nucleotide resolution rather than binary site classification.

Models Taxonomy

Model	Architecture	Input	Output	Resolution	Strength	Fails when
RBPNet (Horlacher et al 2023)	Sequence-to-signal CNN	Sequence	Per-nt CL count distribution	Single-nt	Modern single-nt resolution; predicts CL distribution not binary	New (2023); fewer pretrained RBPs
RNAProt (Uhl 2021)	GRU RNN	Sequence	Binary binding probability	Site/peak	Highest AUC in benchmark (87-89%); feature-rich (RNAplfold structure)	Single-prediction; not per-base profile
GraphProt (Maticzka 2014)	Graph kernel + SVM	Sequence + structure	Binary	Site/peak	Original structure-aware; well-validated	Older; superseded by GraphProt2
GraphProt2 (Uhl 2021)	Graph Convolutional Network (GCN)	Variable-length sequence + structure	Nucleotide-wise binding profile	Per-nt	Variable-length input; structure-aware	Slow to train; needs GPU
DeepCLIP (Gronning 2020)	CNN + BiLSTM	Sequence	Binary	Site	Fast; good benchmarks	Sequence-only; no structure
DeepRiPe (Ghanbari 2020)	Multi-modal CNN	Sequence + region type	Binary	Site	Multi-input; good ENCODE benchmark	Sequence/region must be pre-extracted
iDeep / iDeepE (Pan 2018)	CNN ensemble	Sequence	Binary	Site	Ensemble approach	Older; few pretrained models
Pysster (Budach 2018)	CNN-LSTM	Sequence	Binary	Site	Generic framework	Less RBP-specific
DeepBind (Alipanahi 2015)	CNN	Sequence	Binary	Site	First deep-learning RBP model	Outdated; superseded
Basenji-style multi-task CNN	Multi-task CNN	Sequence	Per-task profile	Per-nt	Joint learning across RBPs	Computational overhead; no dedicated CLIP tool
RNA foundation models (RNAErnie, RNA-FM)

Methodology evolves; verify the latest publication on RBP deep learning (RBPNet 2023 is the current state-of-the-art per-nt resolution model). RNA foundation models (RNA-FM, RNAErnie) are emerging in 2024 as transfer-learning backbones; fine-tuning on CLIP data for specific RBPs is the next-generation approach.

Critical Choice: Binary Classification vs Sequence-to-Signal

Binary classification (RNAProt, DeepCLIP, DeepRiPe, GraphProt2): Train on labeled site vs background; predict probability of binding for an input sequence. Output: per-sequence score. Pro: simple framework; mature benchmarks. Con: discards single-nt CL distribution information; binary decision boundary.

Sequence-to-signal (RBPNet): Train on per-nt CL count distributions from PureCLIP or CTK CITS output; predict per-base CL count for input sequence. Output: per-nt profile. Pro: single-nt resolution; preserves CL count information; matches biology (CL is a sharp signal, not a region). Con: newer (2023); fewer pretrained models; harder to interpret with classical motif tools.

Goal	Model
Predict RBP binding probability for an input sequence	RNAProt or DeepRiPe
Predict per-base CL distribution	RBPNet
Variant-effect at heterozygous SNP	RBPNet or DeepRiPe (per-base output)
Compare RBP preferences across ENCODE	Multi-task model (Basenji-style)
Transfer learning across RBPs	RNA foundation model + fine-tune
In silico screening of variants	RBPNet (per-base) for genome-wide
Motif interpretation via attribution	DeepRiPe or GraphProt2 (interpretable)
Custom training on new CLIP data	RNAProt (easiest pipeline)
Production-grade per-base prediction	RBPNet 2023

Variant-Effect Prediction Workflow

Apply a pretrained or custom-trained model to predict the change in binding upon a sequence variant.

import torch
from rbpnet import RBPNet  # hypothetical API; verify per-package documentation

# Load pretrained model for specific RBP
model = RBPNet.load_pretrained('TARDBP_HEK293T')

# Reference and alternative sequences around a variant
ref_seq = 'CTGTACTGCAGTAGCATGCTAGCATGCTAGCAT'  # 32 nt window centered on variant
alt_seq = 'CTGTACTGCAGTAGCATGCTAGCATGCTAGCAA'  # Variant: T -> A at position 32

# Predict per-base CL distribution for both
ref_pred = model.predict(ref_seq)   # shape: (32, 1) - per-base CL probability
alt_pred = model.predict(alt_seq)

# Variant effect: log2 fold change in summed binding signal
import numpy as np
effect = np.log2((alt_pred.sum() + 1e-9) / (ref_pred.sum() + 1e-9))
print(f'Variant effect (log2 FC): {effect:.4f}')

# Strong-effect variant: |log2 FC| > 1.0
# Mid-effect: 0.5 - 1.0
# Weak: < 0.5

For genome-wide variant scoring: apply this in batch to all GWAS variants overlapping the RBP's binding regions. The output is a per-variant log2 FC; downstream Mendelian randomization or fine-mapping integrates with phenotype-association statistics.

Training a Custom Model (RNAProt Example)

RNAProt is the most accessible training framework. It accepts peak BED + background BED + genome FASTA.

Goal: Train a chromosome-split RNN classifier from CLIP peaks to predict RBP binding probability on arbitrary input sequences, with held-out evaluation on a chromosome-distinct test set.

Approach: Generate a GC-matched 3' UTR background, split peaks and background by chromosome (train chr1-20, test chr21-22) to prevent gene-neighbor leakage, train RNAProt for 50 epochs at batch size 64, and evaluate held-out AUC against the ENCODE benchmark target of 0.85-0.89.

# Step 1: Prepare data
# Foreground: positive peaks from CLIPper / Skipper stringent set
# Background: GC-matched random regions from expressed transcripts
bedtools getfasta -fi genome.fa -bed peaks.stringent.bed -s -fo peaks.fa
bedtools shuffle -i peaks.stringent.bed -g chrom.sizes -incl expressed.bed -seed 42 > bg.bed
bedtools getfasta -fi genome.fa -bed bg.bed -s -fo background.fa

# Step 2: Train RNAProt
RNAProt train \
    --in peaks.fa \
    --neg background.fa \
    --out model_dir \
    --epochs 50 \
    --batch-size 64 \
    --learning-rate 0.001 \
    --validation-split 0.2

# Step 3: Apply to query sequences
RNAProt predict \
    --model model_dir \
    --in query.fa \
    --out predictions.tsv

# Output: per-sequence binding probability

RBPNet Sequence-to-Signal Workflow

# Hypothetical RBPNet API - verify against current package
import rbpnet

# Training: needs per-nt crosslink count for each example
# Inputs: sequence windows (256 nt) around peaks
# Targets: per-base CL count vector from PureCLIP or CTK CITS

# Prepare data
X_train, y_train = rbpnet.load_clip_data(
    peaks_bed='peaks.bed',
    crosslinks_bed='pureclip_sites.bed',
    genome_fa='genome.fa',
    window_size=256
)

# Train
model = rbpnet.RBPNet(
    seq_length=256,
    out_length=256,
    conv_layers=4,
    filters=128
)
model.train(X_train, y_train, epochs=50, batch_size=32, val_split=0.2)

# Predict per-base CL distribution
predictions = model.predict(novel_sequences)

Per-Tool Failure Modes

Training data imbalance

Trigger: Peak set 10k positive vs 100k negative background.

Mechanism: Class imbalance biases model toward negative class; specificity high but sensitivity low.

Symptom: AUC reported at 0.95 but precision-recall at peak threshold poor; few sites recovered.

Fix: Balanced sampling (1:1 positive:negative) or class weights. RNAProt does this automatically; DeepCLIP / DeepRiPe require manual balancing.

Background mismatch

Trigger: Random shuffled background not matched to peak transcript context (e.g., peaks from 3' UTRs, background from CDS).

Mechanism: Model learns transcript-region differences (AU-content of 3' UTR vs CDS), not RBP specificity.

Symptom: Top predicted sites all in 3' UTRs regardless of test sequence; motif analysis shows AU-rich without RBP motif.

Fix: Match background to same region as foreground (3' UTR peaks -> 3' UTR background). Use the GC-content matched shuffle.

Test on training data leak

Trigger: Splitting train/test by random shuffle.

Mechanism: Adjacent peaks in genome share evolutionary context; random split leaks training peaks near test peaks.

Symptom: Held-out AUC > 0.95 in benchmark but fails on truly novel sequences.

Fix: Split by chromosome (e.g., train chr1-20, test chr21-22). Or split by gene (no two peaks in same gene across splits).

GPU requirement underestimated

Trigger: RNAProt / RBPNet training on CPU only.

Mechanism: Modern RBP DL models have 1-10M parameters; training requires GPU (or 100x slower on CPU).

Symptom: Training time > 24 h on CPU; convergence unstable.

Fix: Use Google Colab GPU; AWS EC2 GPU instance; or restricted-architecture model for CPU.

Variant-effect prediction window size

Trigger: Variant-effect prediction with too narrow window around the variant.

Mechanism: RBP context extends 50-200 nt; window < 100 nt misses long-range context.

Symptom: Variant effect estimates noisy; same model gives different effects on different windows.

Fix: Use the model's native window size (256 nt for RBPNet); for shorter windows, average across multiple shifted predictions.

Pretrained models lack the target RBP

Trigger: Looking for pretrained DeepRiPe / RBPNet for an uncommon RBP.

Mechanism: Only ~150 ENCODE-tested RBPs have pretrained models; thousands of RBPs are not.

Symptom: No pretrained available for the protein of interest.

Fix: Train custom model on new CLIP data using RNAProt or DeepCLIP. Or use transfer learning from a related RBP (closest paralog).

Structure prediction integration

Trigger: GraphProt2 with --structure flag without RNA-Fold structure ensemble.

Mechanism: GraphProt2 needs structure ensemble (RNAfold output) as input; without it the GCN cannot leverage structure.

Symptom: GraphProt2 performance no better than sequence-only models.

Fix: Pre-compute RNAfold ensemble for each training sequence; pass to GraphProt2 input. Or use sequence-only DeepCLIP if structure is not needed.

Model interpretation via saliency

Trigger: Want to recover RBP motif from trained model.

Mechanism: Saliency / integrated gradients on trained model produces per-base importance scores; sum across many positive examples gives a motif.

Symptom: Saliency results noisy; no clean motif emerges.

Fix: Use TF-MoDISco (Shrikumar et al 2018) for cleaner motif extraction from saliency maps. Or use DeepLIFT scores instead of vanilla saliency.

Decision Tree by Use Case

Scenario	Model	Why
Variant-effect prediction (genome-wide GWAS variants)	RBPNet (per-base)	Single-nt resolution; predicts CL distribution
Binary "is this sequence bound"	RNAProt	Best AUC in benchmark (87-89%)
Structure-aware prediction	GraphProt2	Structure ensemble integration
Custom training on new CLIP data	RNAProt (easiest CLI)	Fast training; CLI tool
Single RBP, no pretrained	Train custom RNAProt	Most accessible framework
Multi-task across RBPs	Basenji-style	Joint learning
Transfer learning from foundation model	RNA-FM + fine-tune	New approach; not yet in production
Production scoring of many sequences	DeepCLIP (fast inference)	Throughput
Motif interpretation	DeepRiPe + TF-MoDISco	Interpretable architectures
Comparing in silico to RBNS	RBPNet or DeepRiPe + RBNS Kd correlation	Calibration
Variant effect at heterozygous SNP	RBPNet	Per-base output

Reconciliation: Model Predictions vs CLIP / RBNS

Pattern	Likely cause	Action
Model predicts site; CLIP misses	Model false positive; or transient binding not captured by CLIP	Check RBNS prediction; in vitro Kd
Model predicts low; CLIP has strong peak	Model false negative; or non-canonical / context-dependent	Investigate training data; structure-dependent?
Model AUC 0.95 in test; fails on novel sequences	Train/test leakage; chromosome split needed	Re-train with proper split
Variant effect log2 FC inconsistent across windows	Window-size sensitivity	Use model native window; average across shifts
Pretrained for related RBP works on target	Cross-RBP transfer	Transfer learning may work for paralogs
GraphProt2 underperforms sequence-only	Structure ensemble not provided	Fix structure input
Saliency motif noisy	Vanilla gradient method	Use DeepLIFT or TF-MoDISco
Train/test split by random outperforms chromosome split	Leakage from gene-neighbor sequences	Trust chromosome-split AUC

Operational rule for high-confidence variant-effect: (a) Use RBPNet per-base output; (b) compute log2 FC at variant position summed over 50 nt window; (c) cross-validate with another model (DeepRiPe); (d) cross-reference with overlapping eCLIP peak if available; (e) report |log2 FC| > 1 as strong effect.

Common Errors

Error / symptom	Cause	Solution
AUC 0.5 on test	Train data leak or random shuffle	Verify chromosome split
Model trained on 1 epoch	Default optimizer state	Train 30-50 epochs with validation
GPU OOM	Batch size too large	Reduce batch size to 32
Variant effect log2 FC very large (> 10)	Reference sequence not in training distribution	Verify input sequence reasonable
Pretrained model not found	RBP not in pretrained list	Train custom; or use closest paralog
Structure flag without input	GraphProt2 misuse	Pre-compute RNAfold structure
Saliency map flat	Model architecture too shallow	Use DeepRiPe / RBPNet (deeper)
Per-class accuracy uneven	Class imbalance	Use balanced sampling or class weights
Cross-RBP transfer fails	RBPs unrelated	Limit transfer to paralogs or use foundation model
Custom training crashes	RAM / GPU exhausted	Smaller batch; cache embeddings

References

• Alipanahi B et al 2015 Nat Biotechnol 33:831 (DeepBind, first DL RBP model)
• Maticzka D et al 2014 Genome Biol 15:R17 (GraphProt with structure)
• Uhl M et al 2021 bioRxiv 850024 (GraphProt2 with GCN; preprint)
• Gronning AGB et al 2020 Nucleic Acids Res 48:7099 (DeepCLIP)
• Ghanbari M, Ohler U 2020 Genome Res 30:214 (DeepRiPe multi-modal)
• Pan X, Shen HB 2018 Bioinformatics 34:3427 (iDeepE)
• Budach S, Marsico A 2018 Bioinformatics 34:3035 (Pysster)
• Uhl M et al 2021 GigaScience 10:giab054 (RNAProt RNN)
• Horlacher M, Wagner N, Moyon L et al 2023 Genome Biol 24:180 (RBPNet sequence-to-signal at single-nt)
• Shrikumar A et al 2018 arXiv (TF-MoDISco interpretation)
• Chen J et al 2022 arXiv:2204.00300 (RNA-FM foundation model, preprint)
• Wang N et al 2024 Nat Mach Intell 6:548 (RNAErnie)

Related Skills

• clip-seq/clip-motif-analysis - Motif analysis is the classical alternative
• clip-seq/crosslink-site-detection - Single-nt CL sites for sequence-to-signal models
• clip-seq/clip-peak-calling - Peak BEDs for binary classification training
• causal-genomics/mendelian-randomization - Variant-effect predictions feed MR
• causal-genomics/fine-mapping - Variant prioritization with model scores
• machine-learning/model-validation - Train/test split methodology
• machine-learning/prediction-explanation - Saliency / attribution methods
• machine-learning/biomarker-discovery - Generic ML framework