| name | algo-aho-corasick |
| description | Build an Aho-Corasick automaton (trie + BFS failure links) to find every pattern occurrence in one O(n+m+z) text pass. Use for restriction-site/primer/motif search or replacing per-pattern KMP/regex loops over many fixed patterns. |
| tool_type | python |
| primary_tool | Python |
Aho-Corasick Algorithm
When to Use
- Searching a text/sequence for many fixed patterns at once (tens to thousands), e.g. restriction enzyme recognition sites, PCR primer binding sites, transcription-factor motifs, stop/start codons, or a dictionary of known variants/k-mers.
- You would otherwise call KMP or
str.find/regex alternation once per pattern — Aho-Corasick does it in a single pass over the text instead of k passes.
- Patterns are known up front and reused across many texts (build once,
search() many times) — e.g. scanning many contigs/reads against the same motif set.
- You need overlapping matches reported (e.g. "he" inside "she"), which greedy single-pattern scanners typically miss.
- Not a fit: single pattern (use KMP/
algo-kmp-algorithm), or patterns that change on every call (rebuild cost dominates).
Version Compatibility
Pure Python standard library only — no third-party dependency. Verified on Python ≥3.9 (uses list[tuple[str,int]] style type hints available via from __future__ import annotations on 3.7+; native on 3.9+). No API has changed across Python versions relevant here.
Prerequisites
- No packages to install — uses only
collections.deque.
- Prior concepts: trie/prefix-tree traversal (
algo-tries), and KMP failure functions (algo-kmp-algorithm) — Aho-Corasick failure links are the multi-pattern generalization of KMP's.
Goal: find every occurrence of every pattern in a set, in one linear pass over the text.
Approach: insert all patterns into a trie, run a BFS over the trie to attach a failure link to each node (pointing to the longest proper suffix of that node's string that is also some trie prefix), merge each node's failure-link output into its own output list, then scan the text once, following failure links on mismatch instead of restarting.
from collections import deque
class AhoCorasickNode:
"""A node in the Aho-Corasick trie/automaton."""
def __init__(self):
self.children: dict[str, "AhoCorasickNode"] = {}
self.fail: "AhoCorasickNode | None" = None
self.output: list[str] = []
class AhoCorasick:
"""Multi-pattern matcher: O(n + m + z) build+search vs O(n*k) naive.
n = text length, m = total pattern length, k = pattern count, z = match count.
Example:
>>> ac = AhoCorasick()
>>> ac.add_patterns(["he", "she", "hers"])
>>> ac.build()
>>> ac.search("ushers")
[('she', 1), ('he', 2), ('hers', 2)]
"""
def __init__(self):
self.root = AhoCorasickNode()
self.root.fail = self.root
self._built = False
def add_pattern(self, pattern: str) -> None:
"""Insert one pattern into the trie. Must be called before build()."""
if not pattern:
raise ValueError("pattern cannot be empty")
if self._built:
RuntimeError()
node = .root
ch pattern:
node = node.children.setdefault(ch, AhoCorasickNode())
node.output.append(pattern)
() -> :
p patterns:
.add_pattern(p)
() -> :
._built:
queue: deque[AhoCorasickNode] = deque()
child .root.children.values():
child.fail = .root
queue.append(child)
queue:
current = queue.popleft()
ch, child current.children.items():
queue.append(child)
f = current.fail
f .root ch f.children:
f = f.fail
child.fail = f.children[ch] ch f.children .root
child.output = child.output + child.fail.output
._built =
() -> [[, ]]:
._built:
RuntimeError()
results: [[, ]] = []
node = .root
i, ch (text):
node .root ch node.children:
node = node.fail
ch node.children:
node = node.children[ch]
pattern node.output:
results.append((pattern, i - (pattern) + ))
results
Goal: apply the automaton to a real multi-pattern bioinformatics task — locating restriction enzyme recognition sites in a DNA sequence.
Approach: build one automaton from the enzyme-name→recognition-sequence dict, run a single search(), then regroup the flat (pattern, position) hits back by enzyme name.
def find_restriction_sites(dna: str, sites: dict[str, str]) -> dict[str, list[int]]:
"""Find all restriction-enzyme cut sites in a DNA sequence.
Args:
dna: sequence to search (e.g. uppercase A/C/G/T).
sites: enzyme name -> recognition sequence (e.g. {"EcoRI": "GAATTC"}).
Returns:
enzyme name -> sorted list of 0-based match start positions.
"""
seq_to_name = {seq: name for name, seq in sites.items()}
ac = AhoCorasick()
ac.add_patterns(list(sites.values()))
ac.build()
hits: dict[str, list[int]] = {name: [] for name in sites}
for seq, pos in ac.search(dna):
hits[seq_to_name[seq]].append(pos)
for name in hits:
hits[name].sort()
return hits
if __name__ == "__main__":
RECOGNITION_SITES = {"EcoRI": "GAATTC", "BamHI": "GGATCC", "HindIII": "AAGCTT"}
DNA = "ACGTGAATTCTAGGGATCCAAAGCTTCGATCGGAATTCTTAAGCTTGCTAGGATCCGCATGAATTCGCTAGC"
result = find_restriction_sites(DNA, RECOGNITION_SITES)
assert result["EcoRI"] == [4, 32, 60]
assert result["BamHI"] == [13, 50]
result[] == [, ]
(, result)
Complexity
| Phase | Time | Space |
|---|
| Build trie | O(m) | O(m x sigma) |
| Failure links (BFS) | O(m) | O(m) |
| Search | O(n + z) | O(1) extra |
| Total | O(n + m + z) | O(m) |
n = text length, m = total pattern length, z = match count, sigma = alphabet size.
Pitfalls
- Must call
build() before search(): failure links are unset during add_pattern; searching first raises RuntimeError.
- Output-list merging is what makes overlaps work:
child.output = child.output + child.fail.output during BFS is what surfaces "he" inside "she". Skipping this step silently drops all shorter contained patterns.
- Root's self-loop (
root.fail = root) is required — without it the while loop in search() never terminates on repeated mismatches.
- Adding patterns after
build() raises — there is no incremental update; rebuild the whole automaton if the pattern set changes.
- Case sensitivity: matching is exact per-character; normalize both patterns and text (e.g.
.upper()) before inserting/searching, especially for DNA sequences that may mix cases.
- Empty patterns:
add_pattern("") raises ValueError — filter out empty strings from any generated pattern list first.
See Also
algo-kmp-algorithm — single-pattern failure-function matching that Aho-Corasick generalizes.
algo-tries — the underlying trie/prefix-tree data structure.
algo-rabin-karp — hashing-based alternative for single or small pattern sets.
bio-restriction-analysis-restriction-sites — restriction-site finding using dedicated bioinformatics libraries.