| name | bio-read-qc-fastp-workflow |
| description | Runs all-in-one FASTQ preprocessing with fastp in a single pass - adapter trimming via paired-end overlap analysis, quality/length filtering, 2-color poly-G removal, base correction, optional dedup/UMI/merge, and HTML/JSON reports. Use when preprocessing bulk Illumina data and wanting one fast tool instead of separate Cutadapt, Trimmomatic, and FastQC steps. For precise small-RNA/amplicon adapters use adapter-trimming; for molecule-accurate UMI dedup use umi-processing. |
| origin | openai4s |
| category | bioskills/read-qc |
| metadata | {"tool_type":"cli","primary_tool":"fastp","third_party":{"name":"GPTomics/bioSkills","repository":"https://github.com/GPTomics/bioSkills","commit":"d91ed3d563019e649dc854c56ccd62551359488a","license":"MIT"}} |
Version Compatibility
Reference examples tested with: fastp 0.23+, FastQC 0.12+, MultiQC 1.21+
Before using code patterns, verify installed versions match. If versions differ:
- CLI:
<tool> --version then <tool> --help to confirm flags
- Python:
pip show <package> then help(module.function) to check signatures
If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.
fastp Workflow -- one C++ pass for adapter, quality, poly-G, and QC
Run adapter trimming, quality/length filtering, poly-G removal, and reporting in a single fast pass.
"Preprocess my reads with fastp" -> Trim adapters from the read overlap, filter low-quality reads, remove 2-color poly-G, and emit an HTML/JSON report.
- CLI:
fastp -i R1.fq.gz -I R2.fq.gz -o c_R1.fq.gz -O c_R2.fq.gz -h report.html -j report.json
Scope: this skill OWNS general-purpose single-pass Illumina preprocessing. Precise small-RNA/amplicon/anchored adapters -> read-qc/adapter-trimming. Molecule-accurate UMI dedup/consensus -> read-qc/umi-processing. DNA coordinate dedup -> alignment-files/duplicate-handling. OUT OF SCOPE: transcriptome QC (read-qc/rnaseq-qc).
The Single Most Important Modern Insight
-
fastp trims paired-end adapters by OVERLAP ANALYSIS, needing no adapter sequence at all. It aligns R1 against the reverse complement of R2, finds the insert-derived overlap, and trims whatever extends past it (the read-through region) -- so it can trim adapter down to a SINGLE trailing base, where sequence-matching tools need at least 3. The same overlap drives --correction (-c): where the mates disagree and one base is high-quality and the other very low, fastp overwrites the low-quality base with the high-quality call. This overlap machinery is why fastp is the default bulk PE preprocessor and why it needs no --adapter_sequence for standard libraries.
-
--dedup is SEQUENCE-identity deduplication at the FASTQ level -- no coordinates, no UMI -- so it removes BIOLOGICAL duplicates too. It cannot tell a PCR duplicate from a highly expressed transcript's fragment or a targeted amplicon. NEVER use --dedup for RNA-seq quantification, amplicon, or any assay where identical reads are genuine signal. For molecule-accurate removal use UMIs (read-qc/umi-processing); for DNA variant calling use coordinate-based dedup AFTER alignment (alignment-files/duplicate-handling). fastp --dedup is for the narrow case of removing exact-duplicate reads from a non-UMI library where that is known to be safe.
-
Poly-G trimming auto-enables for 2-color instruments (NextSeq/NovaSeq) from the machine ID, because G is the no-signal call. Leave it on; a high-quality poly-G tail is invisible to the quality filter. One fast pass does adapter + quality + poly-G + filtering + QC report, and the JSON feeds MultiQC -- but fastp does NOT replace cutadapt's precision for small-RNA 3' adapters, amplicon primers, or anchored/linked adapters.
Tool Positioning
| Need | Use fastp? | Alternative |
|---|
| Bulk PE WGS/WES/RNA/cfDNA preprocessing | Yes (default) | -- |
| One pass: trim + filter + poly-G + QC report | Yes | -- |
| Small-RNA 3' adapter + tight length gate | No | cutadapt (read-qc/adapter-trimming) |
| Amplicon / anchored / linked primers | No | cutadapt |
| Molecule counting / ctDNA consensus | Extract only | umi_tools / fgbio (read-qc/umi-processing) |
| RNA-seq molecule dedup | No (--dedup is wrong) | UMIs, or do not dedup |
Core Operations
fastp -i in.fq.gz -o out.fq.gz
fastp -i R1.fq.gz -I R2.fq.gz -o c_R1.fq.gz -O c_R2.fq.gz
fastp -i R1.fq.gz -I R2.fq.gz -o c_R1.fq.gz -O c_R2.fq.gz --detect_adapter_for_pe
fastp -i in.fq.gz -o out.fq.gz --adapter_sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
fastp -i in.fq.gz -o out.fq.gz -q 20 -u 40 -n 5
fastp -i in.fq.gz -o out.fq.gz --cut_right --cut_window_size 4 --cut_mean_quality 20 -l 36
fastp -i in.fq.gz -o out.fq.gz --trim_poly_g
fastp -i in.fq.gz -o out.fq.gz --trim_poly_x
fastp -i R1.fq.gz -I R2.fq.gz -o c_R1.fq.gz -O c_R2.fq.gz --correction
fastp -i R1.fq.gz -I R2.fq.gz --merge --merged_out merged.fq.gz -o un_R1.fq.gz -O un_R2.fq.gz
fastp -i R1.fq.gz -I R2.fq.gz -o c_R1.fq.gz -O c_R2.fq.gz --umi --umi_loc read1 --umi_len 8
Key flags: -q qualified quality (default 15), -u unqualified percent limit (40), -n N limit (5), -e average-quality filter (0=off), -l length required (15), --length_limit (0=off), --cut_right/--cut_front/--cut_tail window cut modes (off by default), --cut_window_size (4), --cut_mean_quality (Q20), --thread/-w (default 3), -h/-j HTML/JSON report.
Complete Workflows
fastp -i raw_R1.fq.gz -I raw_R2.fq.gz -o clean_R1.fq.gz -O clean_R2.fq.gz \
--detect_adapter_for_pe --cut_right --cut_window_size 4 --cut_mean_quality 20 \
-q 20 -l 36 -w 8 -h sample.html -j sample.json
fastp -i raw_R1.fq.gz -I raw_R2.fq.gz -o clean_R1.fq.gz -O clean_R2.fq.gz \
--detect_adapter_for_pe --trim_poly_g \
--cut_right --cut_window_size 4 --cut_mean_quality 20 -q 20 -l 36 -w 8 \
-h sample.html -j sample.json
fastp -i raw_R1.fq.gz -I raw_R2.fq.gz -o clean_R1.fq.gz -O clean_R2.fq.gz \
--detect_adapter_for_pe -q 20 -l 50 -w 8 -h sample.html -j sample.json
Parsing the JSON report
import json
with open('sample.json') as f:
report = json.load(f)
after = report['summary']['after_filtering']
print(f"reads kept: {after['total_reads']}, Q30: {after['q30_rate']:.2%}")
print(f"duplication: {report['duplication']['rate']:.2%}")
MultiQC parses fastp JSON directly: multiqc . over a directory of *.json builds the cohort report (read-qc/quality-reports).
Common Errors
| Symptom | Cause | Solution |
|---|
| RNA-seq counts deflated after fastp | Used --dedup (sequence dedup removes biological dups) | Drop --dedup for RNA-seq; never sequence-dedup expression data |
| Adapter not trimmed (SE) | SE has no overlap; relies on data auto-detect | Pass --adapter_sequence explicitly for SE |
| Poly-G remains | 4-color run, or auto-detect missed the instrument | Add --trim_poly_g explicitly |
| Small-RNA results poor | fastp overlap is not precise enough for ~22 nt inserts | Use cutadapt with --discard-untrimmed (read-qc/adapter-trimming) |
| Over-trimmed RNA-seq | Aggressive --cut_right quality | Light trim only; aligner soft-clips (read-qc/quality-filtering) |
| UMI dedup expected but none happened | --umi only EXTRACTS; dedup is post-alignment | Extract here, dedup with umi_tools/fgbio after mapping (read-qc/umi-processing) |
References
Chen S, Zhou Y, Chen Y, Gu J. 2018. fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 34(17):i884-i890.
Chen S. 2023. Ultrafast one-pass FASTQ data preprocessing, quality control, and deduplication using fastp. iMeta 2(2):e107.
Ewels P, Magnusson M, Lundin S, Kaller M. 2016. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics 32(19):3047-3048.
Related Skills
read-qc/adapter-trimming - Precise adapter/primer control for small-RNA and amplicon
read-qc/quality-filtering - Detailed quality/length filtering options and the trim-light evidence base
read-qc/quality-reports - Aggregate fastp JSON across samples with MultiQC
read-qc/umi-processing - Molecule-accurate UMI dedup and consensus after alignment
alignment-files/duplicate-handling - Coordinate-based duplicate marking for DNA variant calling