sequence

name	sequence
description	Analyze biological sequences using Biopython - translate, align, parse FASTA/GenBank
metadata	null

Sequence Analysis

Analyze biological sequences using Biopython. Translate DNA, compute statistics, parse sequence files, and perform basic alignments.

Overview

This skill provides sequence analysis capabilities including:

• DNA/RNA translation to protein
• Sequence statistics (GC content, molecular weight, etc.)
• Reverse complement
• FASTA/GenBank file parsing
• Sequence alignment
• Motif searching

Usage

Translate DNA to protein:

python3 {baseDir}/scripts/sequence_tools.py translate --sequence "ATGCGATCGATCGATCG"

Compute sequence statistics:

python3 {baseDir}/scripts/sequence_tools.py stats --sequence "ATGCGATCGATCGATCG"

Get reverse complement:

python3 {baseDir}/scripts/sequence_tools.py revcomp --sequence "ATGCGATCGATCG"

Parse FASTA file:

python3 {baseDir}/scripts/sequence_tools.py parse --file sequences.fasta --format fasta

Find ORFs:

python3 {baseDir}/scripts/sequence_tools.py orfs --sequence "ATGCGATCGATCGATCGTAG"

Search for motif:

python3 {baseDir}/scripts/sequence_tools.py motif --sequence "ATGCGATCGATCG" --pattern "GATC"

Commands

translate

Translate DNA/RNA sequence to protein.

Parameter	Description	Default
--sequence	DNA/RNA sequence or file	Required
--table	Codon table (1=standard, 2=mitochondrial, etc.)	1
--frame	Reading frame (1, 2, 3, -1, -2, -3)	1
--all-frames	Translate all 6 reading frames	False
--to-stop	Translate until first stop codon	False

stats

Compute sequence statistics.

Parameter	Description	Default
--sequence	Sequence or file	Required
--type	Sequence type: dna, rna, protein, auto	auto

Output includes:

• Length
• GC content (nucleotide)
• Molecular weight
• Base/amino acid composition

revcomp

Get reverse complement of DNA sequence.

Parameter	Description
--sequence	DNA sequence or file

parse

Parse sequence files (FASTA, GenBank, etc.).

Parameter	Description	Default
--file	Input file path	Required
--format	File format: fasta, genbank, embl	auto
--output	Output format: summary, fasta, json	summary

orfs

Find Open Reading Frames.

Parameter	Description	Default
--sequence	DNA sequence or file	Required
--min-length	Minimum ORF length (codons)	30
--table	Codon table	1

motif

Search for sequence motifs/patterns.

Parameter	Description	Default
--sequence	Sequence to search	Required
--pattern	Pattern to find (supports IUPAC codes)	Required

Examples

Translate with specific codon table:

python3 {baseDir}/scripts/sequence_tools.py translate --sequence "ATGCGATCG" --table 2

Get stats for protein sequence:

python3 {baseDir}/scripts/sequence_tools.py stats --sequence "MTEYKLVVVGAGGVGKSALTIQLIQ" --type protein

Parse GenBank file and extract sequences:

python3 {baseDir}/scripts/sequence_tools.py parse --file gene.gb --format genbank --output fasta

Find all ORFs with minimum 50 codons:

python3 {baseDir}/scripts/sequence_tools.py orfs --file genome.fasta --min-length 50

Translate all 6 reading frames:

python3 {baseDir}/scripts/sequence_tools.py translate --sequence "ATGCGATCGATCGATCG" --all-frames

Codon Tables

ID	Description
1	Standard
2	Vertebrate Mitochondrial
3	Yeast Mitochondrial
4	Mold/Protozoan Mitochondrial
5	Invertebrate Mitochondrial
6	Ciliate Nuclear
11	Bacterial/Archaeal/Plant Plastid

IUPAC Codes

Nucleotides

• R = A or G (purine)
• Y = C or T (pyrimidine)
• S = G or C
• W = A or T
• K = G or T
• M = A or C
• N = any nucleotide

Amino Acids

• X = any amino acid
• B = D or N
• Z = E or Q

Notes

• Sequences can be provided directly or as file paths
• Auto-detection identifies DNA/RNA/protein sequences
• Large files are processed efficiently with streaming