소스 정보
- 저장소
- lamm-mit/scienceclaw
- 최근 소스 활동
- 2026년 3월 14일 06:18
- 감지된 SKILL.md 언어
- 영어
- 스타
- 242
- 포크
- 42
설치 방법
기본적으로 소스를 먼저 확인하는 Prompt가 선택됩니다. 직접 명령으로 전환하거나 로컬 사본을 다운로드할 수도 있습니다.
소스 파일 검토
설치 여부를 결정하기 전에 SKILL.md와 SkillsMP에 표시된 보조 파일을 읽어 보세요.
메뉴
기본적으로 소스를 먼저 확인하는 Prompt가 선택됩니다. 직접 명령으로 전환하거나 로컬 사본을 다운로드할 수도 있습니다.
설치 여부를 결정하기 전에 SKILL.md와 SkillsMP에 표시된 보조 파일을 읽어 보세요.
Codex 또는 Claude로 설치 이 Prompt를 복사해 Codex, Claude 또는 다른 어시스턴트에 붙여 넣으면 Skill 페이지를 검토하고 설치를 진행할 수 있습니다.
직접 명령은 검토 Prompt를 거치지 않습니다. 실행하기 전에 소스를 확인하세요.
npx skills add https://github.com/lamm-mit/scienceclaw --skill sequence명령은 한 줄로 유지됩니다. 복사하기 전에 가로로 스크롤해 전체 내용을 확인하세요.
로컬 사본을 원하시나요? SkillsMP에서 현재 제공할 수 있는 파일을 다운로드하세요.
Onboard and manage Paperclip AI for research-paper knowledge and agent orchestration
Generate a structured scientific post and publish it to Infinite. Runs a focused single-agent investigation (PubMed search → LLM analysis → hypothesis/method/findings/conclusion) and posts the result. Faster than scienceclaw-investigate — best for targeted, single-topic posts.
Infinite platform integration for AI agent collaboration
SOC 직업 분류 기준
SKILL.md 표시 중
| name | sequence |
| description | Analyze biological sequences using Biopython - translate, align, parse FASTA/GenBank |
| metadata | null |
Analyze biological sequences using Biopython. Translate DNA, compute statistics, parse sequence files, and perform basic alignments.
This skill provides sequence analysis capabilities including:
python3 {baseDir}/scripts/sequence_tools.py translate --sequence "ATGCGATCGATCGATCG"
python3 {baseDir}/scripts/sequence_tools.py stats --sequence "ATGCGATCGATCGATCG"
python3 {baseDir}/scripts/sequence_tools.py revcomp --sequence "ATGCGATCGATCG"
python3 {baseDir}/scripts/sequence_tools.py parse --file sequences.fasta --format fasta
python3 {baseDir}/scripts/sequence_tools.py orfs --sequence "ATGCGATCGATCGATCGTAG"
python3 {baseDir}/scripts/sequence_tools.py motif --sequence "ATGCGATCGATCG" --pattern "GATC"
Translate DNA/RNA sequence to protein.
| Parameter | Description | Default |
|---|---|---|
--sequence | DNA/RNA sequence or file | Required |
--table | Codon table (1=standard, 2=mitochondrial, etc.) | 1 |
--frame | Reading frame (1, 2, 3, -1, -2, -3) | 1 |
--all-frames | Translate all 6 reading frames | False |
--to-stop | Translate until first stop codon | False |
Compute sequence statistics.
| Parameter | Description | Default |
|---|---|---|
--sequence | Sequence or file | Required |
--type | Sequence type: dna, rna, protein, auto | auto |
Output includes:
Get reverse complement of DNA sequence.
| Parameter | Description |
|---|---|
--sequence | DNA sequence or file |
Parse sequence files (FASTA, GenBank, etc.).
| Parameter | Description | Default |
|---|---|---|
--file | Input file path | Required |
--format | File format: fasta, genbank, embl | auto |
--output | Output format: summary, fasta, json | summary |
Find Open Reading Frames.
| Parameter | Description | Default |
|---|---|---|
--sequence | DNA sequence or file | Required |
--min-length | Minimum ORF length (codons) | 30 |
--table | Codon table | 1 |
Search for sequence motifs/patterns.
| Parameter | Description | Default |
|---|---|---|
--sequence | Sequence to search | Required |
--pattern | Pattern to find (supports IUPAC codes) | Required |
python3 {baseDir}/scripts/sequence_tools.py translate --sequence "ATGCGATCG" --table 2
python3 {baseDir}/scripts/sequence_tools.py stats --sequence "MTEYKLVVVGAGGVGKSALTIQLIQ" --type protein
python3 {baseDir}/scripts/sequence_tools.py parse --file gene.gb --format genbank --output fasta
python3 {baseDir}/scripts/sequence_tools.py orfs --file genome.fasta --min-length 50
python3 {baseDir}/scripts/sequence_tools.py translate --sequence "ATGCGATCGATCGATCG" --all-frames
| ID | Description |
|---|---|
| 1 | Standard |
| 2 | Vertebrate Mitochondrial |
| 3 | Yeast Mitochondrial |
| 4 | Mold/Protozoan Mitochondrial |
| 5 | Invertebrate Mitochondrial |
| 6 | Ciliate Nuclear |
| 11 | Bacterial/Archaeal/Plant Plastid |