Molecular cloning simulation and design. PCR amplicon prediction, restriction enzyme digestion, Golden Gate and Gibson assembly simulation, primer design, CRISPR sgRNA design, and plasmid annotation. For protein-level sequence analysis use biopython or esm; for database lookups use gene-database or ensembl-database.
Instrucciones de origen · Vista previa de solo lectura
name
molecular-cloning
description
Molecular cloning simulation and design. PCR amplicon prediction, restriction enzyme digestion, Golden Gate and Gibson assembly simulation, primer design, CRISPR sgRNA design, and plasmid annotation. For protein-level sequence analysis use biopython or esm; for database lookups use gene-database or ensembl-database.
Molecular Cloning provides computational tools for simulating and designing molecular cloning workflows. This skill covers PCR amplicon prediction with primer binding analysis, restriction enzyme digestion simulation, Golden Gate and Gibson assembly design and verification, primer design with thermodynamic calculations, CRISPR sgRNA design with off-target scoring, and plasmid feature annotation. All simulations use Biopython's Bio.Restriction and Bio.SeqUtils for accurate enzyme and sequence handling.
When to Use This Skill
Predicting PCR amplicons from primer sequences and templates
Simulating restriction enzyme digestions and predicting fragment sizes
Designing Golden Gate assembly with 4bp overhang compatibility
Planning Gibson assembly with overlap design
Designing PCR primers with Tm and specificity constraints
Designing CRISPR sgRNAs and scoring off-target potential
Annotating plasmid features (promoters, CDS, terminators, origins)
Generating plasmid maps in GenBank format
Related Skills: For protein-level sequence analysis use biopython or esm. For gene/transcript lookups use gene-database or ensembl-database. For synthetic biology circuit design use synthetic-biology.
Installation
uv pip install biopython primer3-py numpy
Quick Start
from Bio.Seq import Seq
from Bio.Restriction import BamHI, EcoRI
from Bio.SeqUtils import MeltingTemp as mt
# Restriction digestion
sequence = Seq("ATCGATCGGGATCCATCGATCGAATTCATCGATCG")
print(f"BamHI cuts at: {BamHI.search(sequence)}")
print(f"EcoRI cuts at: {EcoRI.search(sequence)}")
# Primer Tm calculation
primer = Seq("ATCGATCGGATCCATCGATCG")
tm = mt.Tm_NN(primer)
print(f"Primer Tm: {tm:.1f} C")
Core Capabilities
1. PCR Simulation
Predict amplicon from primer binding on template.
from Bio.Seq import Seq
from Bio.SeqUtils import MeltingTemp as mt
import re
deffind_primer_binding(template, primer, max_mismatches=2):
"""Find primer binding sites on template (both strands).
Returns list of (position, strand, mismatches) tuples.
"""
template_str = str(template).upper()
primer_str = str(primer).upper()
rc_template = str(template.reverse_complement()).upper()
sites = []
# Search forward strandfor i inrange(len(template_str) - len(primer_str) + 1):
region = template_str[i:i+len(primer_str)]
mismatches = sum(a != b for a, b inzip(primer_str, region))
if mismatches <= max_mismatches:
sites.append((i, '+', mismatches))
# Search reverse strandfor i inrange(len(rc_template) - len(primer_str) + 1):
region = rc_template[i:i+len(primer_str)]
mismatches = sum(a != b for a, b inzip(primer_str, region))
if mismatches <= max_mismatches:
pos = len(template_str) - i - len(primer_str)
sites.append((pos, '-', mismatches))
return sites
defsimulate_pcr(template, fwd_primer, rev_primer, max_mismatches=2):
"""Simulate PCR and predict amplicon.
Args:
template: Bio.Seq template sequence (can be circular)
fwd_primer: forward primer sequence
rev_primer: reverse primer sequence (as ordered, 5'->3')
"""
fwd_sites = find_primer_binding(template, fwd_primer, max_mismatches)
rev_rc = Seq(str(rev_primer)).reverse_complement()
rev_sites = find_primer_binding(template, rev_rc, max_mismatches)
amplicons = []
for f_pos, f_strand, f_mm in fwd_sites:
if f_strand != '+':
continuefor r_pos, r_strand, r_mm in rev_sites:
if r_strand != '-':
continueif r_pos > f_pos:
amp_len = r_pos + len(str(rev_primer)) - f_pos
if50 < amp_len < 10000: # Reasonable amplicon size
amplicon = template[f_pos:r_pos + len(str(rev_primer))]
amplicons.append({
'start': f_pos,
'end': r_pos + len(str(rev_primer)),
'length': amp_len,
'fwd_mismatches': f_mm,
'rev_mismatches': r_mm,
'sequence': str(amplicon)
})
# Calculate primer Tm
fwd_tm = mt.Tm_NN(fwd_primer)
rev_tm = mt.Tm_NN(rev_primer)
print(f"Forward primer Tm: {fwd_tm:.1f} C")
print(f"Reverse primer Tm: {rev_tm:.1f} C")
print(f"Tm difference: {abs(fwd_tm - rev_tm):.1f} C")
print(f"Predicted amplicons: {len(amplicons)}")
for i, amp inenumerate(amplicons):
print(f" Amplicon {i+1}: {amp['length']} bp "f"(pos {amp['start']}-{amp['end']}, "f"mismatches: fwd={amp['fwd_mismatches']}, rev={amp['rev_mismatches']})")
return amplicons
2. Restriction Digestion
Simulate enzyme digestion and predict fragments.
from Bio.Seq import Seq
from Bio.Restriction import *
from Bio.Restriction import RestrictionBatch, Analysis
defrestriction_digest(sequence, enzymes, is_linear=True):
"""Simulate restriction enzyme digestion.
Args:
sequence: Bio.Seq DNA sequence
enzymes: list of enzyme names (e.g., ['EcoRI', 'BamHI'])
is_linear: True for linear DNA, False for circular
"""# Create restriction batch
rb = RestrictionBatch()
for enz_name in enzymes:
rb.add(eval(enz_name))
# Run analysis
analysis = Analysis(rb, sequence, linear=is_linear)
results = analysis.full()
all_cut_sites = []
for enzyme, sites in results.items():
if sites:
print(f"{enzyme}: cuts at positions {sites}")
all_cut_sites.extend(sites)
else:
print(f"{enzyme}: no cut sites")
# Calculate fragment sizesifnot all_cut_sites:
print(f"No cuts — single fragment: {len(sequence)} bp")
return [len(sequence)]
all_cut_sites = sorted(set(all_cut_sites))
if is_linear:
positions = [0] + all_cut_sites + [len(sequence)]
else:
positions = all_cut_sites
fragments = []
if is_linear:
for i inrange(len(positions) - 1):
fragments.append(positions[i+1] - positions[i])
else:
for i inrange(len(positions)):
next_i = (i + 1) % len(positions)
if next_i == 0:
frag = len(sequence) - positions[i] + positions[0]
else:
frag = positions[next_i] - positions[i]
fragments.append(frag)
fragments.sort(reverse=True)
print(f"\nFragments ({len(fragments)}): {fragments}")
print(f"Total: {sum(fragments)} bp")
return fragments
# Example: double digest
seq = Seq("ATCG" * 100 + "GGATCC" + "ATCG" * 50 + "GAATTC" + "ATCG" * 75)
frags = restriction_digest(seq, ['BamHI', 'EcoRI'], is_linear=True)
3. Golden Gate Assembly
Design and simulate Golden Gate cloning.
from Bio.Seq import Seq
defdesign_golden_gate(parts, enzyme='BsaI'):
"""Design Golden Gate assembly with verified overhang compatibility.
Args:
parts: list of dicts with 'name', 'sequence' keys
enzyme: Type IIS enzyme ('BsaI' or 'BpiI')
"""# Standard overhangs for 4-part Golden Gate
standard_overhangs = [
'AATG', # Start codon region'AGGT',
'TTCG',
'GCTT',
'CGCT', # After last part (return to vector)
]
iflen(parts) + 1 > len(standard_overhangs):
raise ValueError(f"Too many parts ({len(parts)}) for standard overhang set")
# Check overhang compatibility (no palindromes, no near-matches)
overhangs_used = standard_overhangs[:len(parts) + 1]
for i, oh inenumerate(overhangs_used):
rc = str(Seq(oh).reverse_complement())
if oh == rc:
print(f"WARNING: Overhang {oh} is palindromic — may self-ligate")
for j, oh2 inenumerate(overhangs_used):
if i != j and oh == oh2:
raise ValueError(f"Duplicate overhangs: position {i} and {j}")
# Build assembly plan
assembly = []
for i, part inenumerate(parts):
left_oh = overhangs_used[i]
right_oh = overhangs_used[i + 1]
# Part with enzyme sites addedif enzyme == 'BsaI':
recognition = 'GGTCTC'
spacer = 'N'else: # BpiI
recognition = 'GAAGAC'
spacer = 'NN'
assembled_part = f"{recognition}{spacer}{left_oh}{part['sequence']}{right_oh}"
assembly.append({
'name': part['name'],
'left_overhang': left_oh,
'right_overhang': right_oh,
'part_length': len(part['sequence']),
'total_length': len(assembled_part)
})
print(f"Part {i+1} ({part['name']}): [{left_oh}]--{len(part['sequence'])}bp--[{right_oh}]")
# Predict assembled product
total_insert = sum(len(p['sequence']) for p in parts) + \
len(overhangs_used) * 4# Overhangs contribute 4bp eachprint(f"\nAssembly: {len(parts)} parts")
print(f"Total insert: ~{total_insert} bp (excluding vector)")
print(f"Overhang set: {' -> '.join(overhangs_used)}")
return assembly
# Example
parts = [
{'name': 'Promoter', 'sequence': 'TTGACAATTAATCATCGGCTCG' * 5},
{'name': 'RBS', 'sequence': 'AAGGAGATATACAT'},
{'name': 'GFP_CDS', 'sequence': 'ATGGTGAGCAAGGGCGAG' * 40},
{'name': 'Terminator', 'sequence': 'TTTTTTTTTTT' * 4},
]
assembly = design_golden_gate(parts)
4. Gibson Assembly
Design overlapping fragments for Gibson assembly.
from Bio.Seq import Seq
from Bio.SeqUtils import MeltingTemp as mt
defdesign_gibson_assembly(fragments, overlap_length=30):
"""Design Gibson assembly with overlap primers.
Args:
fragments: list of dicts with 'name', 'sequence' keys (in assembly order)
overlap_length: overlap length in bp (20-40 recommended)
"""
assembly_plan = []
for i inrange(len(fragments)):
current = fragments[i]
next_frag = fragments[(i + 1) % len(fragments)]
# Forward primer: end of previous fragment + start of currentif i == 0:
fwd_primer = current['sequence'][:20]
else:
prev = fragments[i - 1]
overlap_5 = prev['sequence'][-overlap_length:]
fwd_primer = overlap_5 + current['sequence'][:20]
# Reverse primer: RC of (end of current + start of next)
overlap_3 = next_frag['sequence'][:overlap_length]
rev_binding = str(Seq(current['sequence'][-20:]).reverse_complement())
rev_primer = str(Seq(overlap_3).reverse_complement()) + rev_binding
# Tm of binding region
fwd_tm = mt.Tm_NN(Seq(current['sequence'][:20]))
rev_tm = mt.Tm_NN(Seq(current['sequence'][-20:]))
assembly_plan.append({
'fragment': current['name'],
'fragment_length': len(current['sequence']),
'fwd_primer': fwd_primer,
'rev_primer': rev_primer,
'fwd_tm': fwd_tm,
'rev_tm': rev_tm,
'overlap_length': overlap_length
})
print(f"Fragment {i+1} ({current['name']}): {len(current['sequence'])} bp")
print(f" Fwd primer: {fwd_primer[:40]}... ({len(fwd_primer)} nt, Tm={fwd_tm:.1f} C)")
print(f" Rev primer: {rev_primer[:40]}... ({len(rev_primer)} nt, Tm={rev_tm:.1f} C)")
total = sum(len(f['sequence']) for f in fragments)
print(f"\nTotal assembled length: ~{total} bp")
return assembly_plan
# Target: exon 3 of a gene
target_exon = "ATGCGATCGATCGATCGATCGATCGAGGCGATCGATCGATCGATCGATCGATCGATCGATCG"
guides = design_crispr_guides(target_exon, pam='NGG', top_n=5)
Best Practices
Primer design — aim for Tm within 2 C between forward and reverse primers; 40-60% GC content; avoid 3' complementarity
Golden Gate — verify 4bp overhangs are unique and non-palindromic; use standardized overhang sets from published studies
Gibson assembly — use 20-40bp overlaps; ensure fragments have similar Tm at overlap junctions; minimum 2 fragments
CRISPR guides — avoid poly-T (>4 T) which terminates U6/H1 transcription; prefer guides in early exons; validate against off-target databases
Restriction digestion — always check both orientations; verify compatible cohesive ends for ligation; methylation sensitivity can block cutting
Plasmid annotation — verify ORFs are in correct reading frame; check for cryptic promoters; map all unique restriction sites for future cloning
Troubleshooting
Problem: PCR simulation finds no amplicons
Solution: Check primer orientation (forward should match sense strand 5'->3'). Increase max_mismatches. Verify template contains the target region.
Problem: Restriction enzyme doesn't cut expected site
Solution: Check for CpG methylation sensitivity (dam/dcm methylation). Verify site isn't in a modified context. Use isoschizomers() to find alternatives.
Problem: Golden Gate assembly produces wrong product
Solution: Verify all overhangs are unique. Check enzyme is BsaI (not BsmBI) — different cut distances. Ensure parts are in correct orientation.
Problem: primer3 returns no primers
Solution: Relax constraints: widen Tm range, increase max size, lower GC requirement. Ensure target region has sufficient flanking sequence.
Problem: CRISPR guide design returns few candidates
Solution: Expand search region (use full gene, not just one exon). Try alternative PAM sequences (NAG for relaxed SpCas9). Consider Cas12a (TTTV PAM) for AT-rich regions.