Skip to main content

bio-transcription-translation

Transcribe DNA to RNA and translate to protein using Biopython, with NCBI codon-table selection, CDS validation, and six-frame ORF finding. Use when converting a CDS or ORF to its amino-acid sequence, selecting a non-standard (mitochondrial, bacterial, ciliate) genetic code, validating a coding sequence, or scanning all reading frames.

Ir para a instalação

Informações da origem

Repositório
GPTomics/bioSkills
Última atividade na origem
11 de agosto de 2026 às 22:36
Idioma detectado do SKILL.md
inglês
Estrelas
1.209
Forks
251

Opções de instalação

Por padrão, está selecionado o prompt que primeiro revisa a origem. Você pode mudar para um comando direto ou baixar uma cópia local.

Revise os arquivos de origem

Leia o SKILL.md e os arquivos complementares exibidos pelo SkillsMP antes de decidir se vai instalar.

Explorador de arquivos
5 arquivos

Exibindo SKILL.md

SKILL.md
Instruções da origem · Visualização somente leitura
name
bio-transcription-translation
description
Transcribe DNA to RNA and translate to protein using Biopython, with NCBI codon-table selection, CDS validation, and six-frame ORF finding. Use when converting a CDS or ORF to its amino-acid sequence, selecting a non-standard (mitochondrial, bacterial, ciliate) genetic code, validating a coding sequence, or scanning all reading frames.
tool_type
python
primary_tool
Bio.Seq
## Version Compatibility Reference examples tested with: BioPython 1.83+ Before using code patterns, verify installed versions match. If versions differ: - Python: `pip show <package>` then `help(module.function)` to check signatures If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying. # Transcription and Translation **"Translate my DNA sequence to protein"** -> Transcribe DNA to RNA and translate to protein, choosing the right genetic code and validating the reading frame. - Python: `Seq.translate()`, `Seq.transcribe()`, `Bio.Data.CodonTable` (BioPython) ## The Governing Principle The single most dangerous bug in translation is **silent**: a valid-but-wrong `table=` argument produces a plausible wrong protein with no error. Translating human mitochondrial DNA with the default Standard code (table 1) inserts `*` where UGA actually codes Trp and truncates at AGA/AGG (which are stops in vertebrate mito). The protein looks real and nothing complains. By contrast, an *unknown* table id or name raises `KeyError` (loud). Only valid-but-wrong tables corrupt silently. The defense: when the input is a complete coding sequence, pass `cds=True`. It converts silent traps into loud `TranslationError` exceptions by validating start, length, and stop. Use it for ORF validation rather than trusting a clean-looking output. Since the Biopython 1.78 alphabet removal, `transcribe()`, `back_transcribe()`, and `translate()` perform NO type checking. Transcribing a protein or translating the wrong strand returns silent garbage. Confirm the molecule and strand before converting. ## Required Import ```python from Bio.Seq import Seq from Bio.Data import CodonTable ``` ## Transcription Is a String Operation, Not Biology `transcribe()` is a pure T->U replacement on the coding (sense) strand; `back_transcribe()` is U->T. Neither performs splicing, intron removal, 5' capping, or poly-A addition. The Biopython tutorial states plainly that all transcribe does is replace T with U. ```python coding_dna = Seq('ATGCGATCGATCG') rna = coding_dna.transcribe() # Seq('AUGCGAUCGAUCG'), T->U only back = rna.back_transcribe() # Seq('ATGCGATCGATCG'), U->T only ``` True biological transcription starts from the template strand, so reverse-complement first: ```python template = Seq('CGATCGATCGCAT') mrna = template.reverse_complement().transcribe() ``` Translation accepts DNA or RNA directly, so explicit transcription is rarely needed before `translate()`. ## Translation Basics ```python coding_dna = Seq('ATGTTTGGT') coding_dna.translate() # Seq('MFG'), from DNA Seq('AUGUUUGGU').translate() # Seq('MFG'), from RNA ``` ### Stop-Codon Behavior `translate()` substitutes `stop_symbol` (default `'*'`) for EVERY in-frame stop, so internal stops appear as `*` mid-protein. `to_stop=True` instead halts at the first in-frame stop and does NOT append the symbol. ```python seq = Seq('ATGTTTGGTTAAGGG') seq.translate() # Seq('MFG*G'), stop shown, translation continues seq.translate(to_stop=True) # Seq('MFG'), halts at first stop ``` ## NCBI Codon Tables: Which Code, and the Consequence of the Wrong One Biopython exposes every NCBI genetic code by integer id or registered name. Selecting the wrong one is the #1 silent bug (see governing principle). | ID | Name | Key reassignments vs Standard | When it matters | |----|------|-------------------------------|-----------------| | 1 | Standard | none (baseline) | Most nuclear genes | | 2 | Vertebrate Mitochondrial | AGA/AGG -> STOP; AUA -> Met; UGA -> Trp | Human/vertebrate mtDNA (4 stops: UAA, UAG, AGA, AGG) | | 3 | Yeast Mitochondrial | CUN (all four CU*) -> Thr; AUA -> Met; UGA -> Trp | **CTG -> Thr lives HERE, not table 12** | | 4 | Mold/Protozoan Mito + Mycoplasma/Spiroplasma | UGA -> Trp (only change) | Fungal/protozoan mito; Mycoplasma | | 5 | Invertebrate Mitochondrial | AGA/AGG -> Ser; AUA -> Met; UGA -> Trp | Insect/worm mito (AGA/AGG=Ser, not STOP as in table 2) | | 6 | Ciliate Nuclear | UAA/UAG -> Gln; only UGA stays stop | Tetrahymena, Paramecium (single stop) | | 11 | Bacterial/Archaeal/Plastid | same coding as Standard; expanded starts | Prokaryotes, plastids (differs from 1 mainly in initiation) | | 12 | Alternative Yeast Nuclear | CUG -> Ser (from Leu) | *Candida* CUG-Ser clade | **Explicit correction:** CTG -> Thr is table **3** (Yeast Mitochondrial). Table **12** is CUG -> **Ser**. Do not conflate them. ```python seq = Seq('ATGGCCTGA') seq.translate(table=2) # by NCBI integer id seq.translate(table='Vertebrate Mitochondrial') # by registered name CodonTable.unambiguous_dna_by_id[2] CodonTable.unambiguous_dna_by_name['Vertebrate Mitochondrial'] ``` ## Validating a Coding Sequence with cds=True **Goal:** Translate a complete ORF and have any structural defect raise a loud error instead of producing a silent wrong protein. **Approach:** Pass `cds=True`. It enforces four conditions, each raising `Bio.Data.CodonTable.TranslationError` on failure: (1) first codon is a start codon for the chosen table; (2) length is a multiple of 3; (3) sequence ends in a stop; (4) no internal in-frame stop. A valid alternative start (GTG/TTG/ATT) is translated as M, biologically correct for fMet initiation. The terminal stop is stripped from the output. **Reference (BioPython 1.83+):** ```python cds = Seq('ATGTTTGGTTAA') cds.translate(cds=True) # Seq('MFG'), validated, terminal stop removed alt_start = Seq('GTGTTTGGTTAA') alt_start.translate(table=11, cds=True) # Seq('MFG'), GTG start -> M under bacterial code ``` Start-codon lists differ by table: table 1 = TTG/CTG/ATG; table 2 = ATT/ATC/ATA/ATG/GTG; table 11 = TTG/CTG/ATT/ATC/ATA/ATG/GTG. A start valid under one table fails under another, which is exactly the loud signal `cds=True` provides. ## translate() Parameters and Edge Cases Signature (the `Seq.translate` METHOD): `translate(table='Standard', stop_symbol='*', to_stop=False, cds=False, gap='-')`. The `Seq` method defaults to `gap='-'`, while both the module-level `Bio.Seq.translate(sequence, ...)` function and `SeqRecord.translate()` default to `gap=None`. - **Partial codon** (length not a multiple of 3): emits a `BiopythonWarning` and SILENTLY drops the trailing 1-2 bases. Easy to miss in a pipeline. Under `cds=True` the same condition becomes a loud `TranslationError`. - **Gaps:** because the `Seq` method defaults to `gap='-'`, a full gap codon `'---'` already translates to `'-'` (e.g. `Seq('GTG---GCCATT').translate()` -> `'V-AI'`, no error). A codon mixing gaps and bases (`'TT-'`) raises `TranslationError`. `SeqRecord.translate()` instead defaults to `gap=None`, so even a full `'---'` codon raises unless `gap='-'` is passed; mixed gap/base codons still raise. For alignment-derived CDS, preserve codon and alignment semantics with `alignment/multiple-alignment` or the project's established translation wrapper rather than assuming one gap-normalization policy. - **Dual-coding stop tables (27 Karyorelict, 28 Condylostoma, 31 Blastocrithidia Nuclear):** these reassign a stop codon so it codes both an amino acid and stop, so `to_stop=True` raises a `ValueError` (no single truncation point). ```python Seq('ATGTTTGG').translate() # BiopythonWarning, trailing 'GG' dropped -> Seq('MF') Seq('ATGTTTGG').translate(cds=True) # TranslationError: length not a multiple of three ``` ## Selenocysteine and Pyrrolysine Are Silently Lost Selenocysteine (Sec, one-letter U) is encoded by UGA and pyrrolysine (Pyl, one-letter O) by UAG, both normally stop codons. Recoding requires a SECIS (Sec) or PYLIS (Pyl) element that Biopython does NOT detect. No NCBI table maps UGA->U or UAG->O. Naive translation therefore yields `*` mid-protein, and `to_stop=True` SILENTLY truncates the protein at that position. Real selenoproteins (GPX, TXNRD, SELENOP) come out truncated or peppered with `*`. There is no clean Biopython workaround; flag these genes and handle the recoding event manually. ## Six-Frame Translation **Goal:** Translate a DNA sequence in all six frames (three forward, three reverse) to expose every possible protein product. **Approach:** For each strand, offset by 0, 1, 2 bases, trim to a multiple of 3, and translate. **Reference (BioPython 1.83+):** ```python def six_frame_translation(seq): frames = [] for strand, s in [('+', seq), ('-', seq.reverse_complement())]: for frame in range(3): length = 3 * ((len(s) - frame) // 3) fragment = s[frame:frame + length] frames.append((strand, frame, fragment.translate())) return frames seq = Seq('ATGCGATCGATCGATCGATCG') for strand, frame, protein in six_frame_translation(seq): print(f'{strand}{frame}: {protein}') ``` ## Find All ORFs (Start to Stop) **Goal:** Identify all open reading frames (Met to stop) across both strands and all three frames, keeping only those above a minimum length. **Approach:** Translate each of the six frames, then scan each translation for Met-to-stop segments meeting the threshold. **Reference (BioPython 1.83+):** ```python def find_orfs(seq, min_protein_length=30): orfs = [] for strand, s in [('+', seq), ('-', seq.reverse_complement())]: for frame in range(3): end = frame + 3 * ((len(s) - frame) // 3) trans = str(s[frame:end].translate()) aa_start = 0 while True: start = trans.find('M', aa_start) if start == -1: break stop = trans.find('*', start) if stop == -1: stop = len(trans) orf = trans[start:stop] if len(orf) >= min_protein_length: orfs.append((strand, frame, start * 3 + frame, orf)) aa_start = start + 1 return orfs seq = Seq('ATGCGATCGATCGATCGATCGTAA') for strand, frame, pos, orf in find_orfs(seq, min_protein_length=3): print(f'{strand} frame {frame} pos {pos}: {orf}') ``` ## Inspect a Codon Table ```python table = CodonTable.unambiguous_dna_by_id[2] table.start_codons # ['ATT', 'ATC', 'ATA', 'ATG', 'GTG'] table.stop_codons # ['TAA', 'TAG', 'AGA', 'AGG'] table.forward_table['TGA'] # 'W' under vertebrate mito code ``` ## Common Errors | Symptom | Cause | Fix | |---------|-------|-----| | Plausible protein, wrong residues, no error | Valid-but-wrong `table=` (e.g. mito DNA on table 1) | Select the organism's NCBI table; use `cds=True` to validate | | `*` mid-protein or premature truncation | Selenoprotein/pyrrolysine UGA/UAG, or wrong table where UGA=Trp | Use correct mito table for UGA=Trp; Sec/Pyl recoding is not automatic | | `TranslationError: First codon ... is not a start codon` | `cds=True` on a sequence not starting at a valid start for that table | Trim to the true start, or pick the table whose starts include it | | `TranslationError: ... is not a multiple of three` | `cds=True` on a partial CDS | Trim to a full ORF; without `cds=True` this only warns and drops trailing bases | | `TranslationError: Extra in frame stop codon found` | Internal stop under `cds=True` | Wrong frame, wrong table, or genuine internal stop; re-check frame/table | | Garbage protein from a protein input | `transcribe()`/`translate()` on a non-nucleotide Seq (no type checks since 1.78) | Verify molecule type before converting | | `KeyError` | Unknown table id or name | Use a valid NCBI id (1-6, 9-16, 21-31) or registered name | ## Decision Tree ``` Need to convert a sequence? ├── DNA <-> RNA (string-level T<->U)? │ ├── coding strand to RNA -> seq.transcribe() │ ├── RNA back to DNA -> seq.back_transcribe() │ └── template strand to mRNA -> seq.reverse_complement().transcribe() ├── DNA/RNA to protein? │ ├── alignment-derived CDS -> alignment/multiple-alignment (codon-aware), or project wrapper │ ├── complete CDS to validate -> translate(cds=True) [loud on defects] │ ├── stop at first stop only -> translate(to_stop=True) │ ├── non-standard organism -> translate(table=N) [pick from the table above] │ └── show internal stops -> translate() [* per stop] └── Unknown coding regions? -> six-frame translation, then scan M...* for ORFs ``` ## Related Skills - seq-objects - Create and inspect Seq objects before translation - reverse-complement - Strand handling for six-frame translation and template-strand transcription - codon-usage - Analyze codon bias and adaptation in coding sequences - sequence-io/read-sequences - Parse GenBank/FASTA records and CDS features for translation ## References The genetic-code tables and their organism assignments follow the NCBI Taxonomy "The Genetic Codes" page, compiled by Andrzej (Anjay) Elzanowski and Jim Ostell at NCBI (https://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi). This is a maintained web resource; cite it as the NCBI page rather than as a journal article.
Ver no GitHub