메뉴
Use when you need to remove adapter sequences from high-throughput sequencing reads, trim low-quality bases, or filter reads by length. Supports single-end and paired-end FASTQ/FASTA input with error-tolerant adapter matching.
기본적으로 소스를 먼저 확인하는 Prompt가 선택됩니다. 직접 명령으로 전환하거나 로컬 사본을 다운로드할 수도 있습니다.
설치 여부를 결정하기 전에 SKILL.md와 SkillsMP에 표시된 보조 파일을 읽어 보세요.
Codex 또는 Claude로 설치 이 Prompt를 복사해 Codex, Claude 또는 다른 어시스턴트에 붙여 넣으면 Skill 페이지를 검토하고 설치를 진행할 수 있습니다.
직접 명령은 검토 Prompt를 거치지 않습니다. 실행하기 전에 소스를 확인하세요.
npx skills add https://github.com/vimalinx/bio-agent --skill cutadapt명령은 한 줄로 유지됩니다. 복사하기 전에 가로로 스크롤해 전체 내용을 확인하세요.
로컬 사본을 원하시나요? SkillsMP에서 현재 제공할 수 있는 파일을 다운로드하세요.
Use when joint-genotyping one or more germline gVCFs into a cohort VCF with GATK GenotypeGVCFs.
Use when running GATK HaplotypeCaller to emit per-sample germline variant calls or gVCFs from analysis-ready BAM/CRAM inputs.
Use when splitting mixed accession-like text into one lowercase token per line in EDirect-style text pipelines.
SOC 직업 분류 기준
SKILL.md 표시 중
| name | cutadapt |
| description | Use when you need to remove adapter sequences from high-throughput sequencing reads, trim low-quality bases, or filter reads by length. Supports single-end and paired-end FASTQ/FASTA input with error-tolerant adapter matching. |
| disable-model-invocation | true |
| user-invocable | true |
cutadapt -a ADAPTER -o output.fastq input.fastq/home/vimalinx/miniforge3/envs/bio/bin/cutadaptcutadapt over fastp when the adapter model itself needs precise control.# 1) Trim a known 3' adapter from single-end reads
cutadapt \
-a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
-o sample.trimmed.fastq.gz \
sample.fastq.gz
# 2) Paired-end trimming with separate R1/R2 adapters
cutadapt \
-a ADAPTER_R1 \
-A ADAPTER_R2 \
-o sample_R1.trimmed.fastq.gz \
-p sample_R2.trimmed.fastq.gz \
sample_R1.fastq.gz sample_R2.fastq.gz
# 3) Adapter trimming plus quality/length filtering
cutadapt \
-a ADAPTER \
-q 20 \
-m 50 \
--json sample.cutadapt.json \
-o sample.trimmed.fastq.gz \
sample.fastq.gz
-a, -g, or -b rather than using a vague fallback.-o, reads go to stdout; that is fine for piping, but dangerous if you expected a file.-b/--anywhere is powerful but easy to misuse; do not use it unless you really want 5' or 3' matching.-j to parallelize larger jobs; default execution is single-core.